Stem-loop hsa-mir-451a

Accession

MI0001729

Symbol

HGNC: MIR451A

Description

Homo sapiens hsa-mir-451a precursor miRNA

Gene family

MIPF0000148; mir-451

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR451A is a functional miRNA expressed in red blood cells (RBCs) that is involved in the regulation of cellular functions [PMC5772623]. It has been shown that MIR451A is transferred from infected RBCs to endothelial cells via extracellular vesicles (EVs) [PMC5772623]. The EVs containing MIR451A form a RNA-induced silencing complex (RISC) with Argonaute-2 [PMC7005784]. The expression of MIR451A in EVs has been found to be altered in various conditions. For example, in exosomes released from glioblastoma neurosphere cells, MIR451A exhibited a significant increase [PMC4598952]. Conversely, in EVs from epithelial ovarian cancer patients, the expression of MIR451A was decreased compared to the control group [PMC8997481]. In colorectal cancer cells, overexpression of MIR451A led to a decrease in the level of linc00467 [PMC7471755]. In addition, hemolysis markers such as miR-23a and MIR451A have been used to assess hemolysis in plasma samples [PMC6683928]. The expression level profile of parent cells, such as RBCs and MIR451A, is mirrored in EVs [PMC6992906]. Furthermore, the levels of MIR451A have been associated with inflammatory responses to influenza A virus vaccines [PMC8087664]. Finally, MYBPC1 has been identified as a target gene regulated by MIR451A through activating transcription factor-2 (ATF-2) and plays an important role in laryngeal carcinoma cellular functions regulation [PMC9760473].

Literature search

287 open access papers mention hsa-mir-451a
(1370 sentences)

Sequence

1250752 reads, 5013 reads per million, 125 experiments

cuugggaauggcaaggAAACCGUUACCAUUACUGAGUUuaguaaugguaaugguucucuugcuauacccaga
.(((((.(((((((((.(((((((((((((((((....))))))))))))))))).))))))))).))))).

Structure

c     a         A                 A 
 uuggg auggcaagg AACCGUUACCAUUACUG G
 ||||| ||||||||| |||||||||||||||||  
 gaccc uaucguucu uugguaaugguaaugau U
a     a         c                 U 

Annotation confidence Not enough data

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr17: 28861369-28861440 [-]

Clustered miRNAs

3 other miRNAs are < 10 kb from hsa-mir-451a

Disease association

hsa-mir-451a is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-451a is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-451a is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-451a

• Accession: MIMAT0001631
• Description: Homo sapiens hsa-miR-451a mature miRNA
• Sequence: 17 - AAACCGUUACCAUUACUGAGUU - 38
• Evidence: experimental ; cloned [1-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706


3. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267