WARNING: This summary was generated by AI. mmu-mir-451 is a microRNA that plays a role in gene regulation in mice, known to target the 3’-UTR of p300, a gene involved in transcriptional regulation, and is associated with the destabilization of cytokine mRNAs [PMC4114167]. Despite its known functions, mmu-mir-451 did not appear in a particular analysis, possibly due to differences between human and mouse species or due to stringent filter settings [PMC3627585]. It is used as a reference gene for normalization in studies comparing different treatment conditions [PMC3929876], and its expression has been quantified using specific assays in developmental studies of the mouse spinal cord [PMC3735597]. mmu-mir-451 has been identified as an early regulator for lung non-specific genes [PMC3866260], and its overexpression has been experimentally induced using mimics in T-cell acute lymphoblastic leukemia (T-ALL) cells [PMC3135352]. It is differentially expressed following low-fat diet treatment, suggesting its involvement in obesity-related gene expression changes [PMC4571067], although calorie restriction did not significantly affect mmu-mir-451 expression levels according to one study [PMC5559175]. Its regulation by GATA-1 has been demonstrated in mouse erythroid cells [PMC3874166], and it shares homology with human miR-451, with implications for AMPK signaling pathways based on studies of homologous miRNAs across species [PMC6600136]. Finally, mmu-mir-451 levels were found to be significantly higher following infection conditions as shown by RT-qPCR analysis on infected red blood cells (iRBCs) compared to non-infected ones (nRBCs) [PMC5583671].
cu a A A uggga uggcgagg AACCGUUACCAUUACUG G ||||| |||||||| ||||||||||||||||| acccu gucguucu uuggcaaugguaaugau U ac c c U
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0001632 |
| Description | Mus musculus mmu-miR-451a mature miRNA |
| Sequence | 17 - AAACCGUUACCAUUACUGAGUU - 38 |
| Evidence |
experimental
cloned [1-3], Illumina [4-5] |
| Database links |
|
| Predicted targets |
|
|