miRBase entry: mmu-mir-451a

Stem-loop mmu-mir-451a


Accession
MI0001730
Symbol
MGI: Mir451a
Description
Mus musculus mmu-mir-451a precursor miRNA mir-451
Gene
family?
RF00722; mir-451

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. mmu-mir-451 is a microRNA that plays a role in gene regulation in mice, known to target the 3’-UTR of p300, a gene involved in transcriptional regulation, and is associated with the destabilization of cytokine mRNAs [PMC4114167]. Despite its known functions, mmu-mir-451 did not appear in a particular analysis, possibly due to differences between human and mouse species or due to stringent filter settings [PMC3627585]. It is used as a reference gene for normalization in studies comparing different treatment conditions [PMC3929876], and its expression has been quantified using specific assays in developmental studies of the mouse spinal cord [PMC3735597]. mmu-mir-451 has been identified as an early regulator for lung non-specific genes [PMC3866260], and its overexpression has been experimentally induced using mimics in T-cell acute lymphoblastic leukemia (T-ALL) cells [PMC3135352]. It is differentially expressed following low-fat diet treatment, suggesting its involvement in obesity-related gene expression changes [PMC4571067], although calorie restriction did not significantly affect mmu-mir-451 expression levels according to one study [PMC5559175]. Its regulation by GATA-1 has been demonstrated in mouse erythroid cells [PMC3874166], and it shares homology with human miR-451, with implications for AMPK signaling pathways based on studies of homologous miRNAs across species [PMC6600136]. Finally, mmu-mir-451 levels were found to be significantly higher following infection conditions as shown by RT-qPCR analysis on infected red blood cells (iRBCs) compared to non-infected ones (nRBCs) [PMC5583671].

Literature search
132 open access papers mention mmu-mir-451a
(708 sentences)

Sequence

3358320 reads, 6866 reads per million, 99 experiments
cuugggaauggcgaggAAACCGUUACCAUUACUGAGUUuaguaaugguaacgguucucuugcugcucccaca
..(((((.((((((((.(((((((((((((((((....))))))))))))))))).)))))))).)))))..

Structure
cu     a        A                 A 
  uggga uggcgagg AACCGUUACCAUUACUG G
  ||||| |||||||| |||||||||||||||||  
  acccu gucguucu uuggcaaugguaaugau U
ac     c        c                 U 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 78073170-78073241 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-451a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-451a

Accession MIMAT0001632
Description Mus musculus mmu-miR-451a mature miRNA
Sequence 17 - AAACCGUUACCAUUACUGAGUU - 38
Evidence experimental
cloned [1-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267