Stem-loop mmu-mir-451a

Accession

MI0001730

Symbol

MGI: Mir451a

Description

Mus musculus mmu-mir-451a precursor miRNA mir-451

Gene
family

RF00722; mir-451

Literature search

132 open access papers mention mmu-mir-451a
(708 sentences)

Sequence

3358336 reads, 9802 reads per million, 99 experiments

cuugggaauggcgaggAAACCGUUACCAUUACUGAGUUuaguaaugguaacgguucucuugcugcucccaca
..(((((.((((((((.(((((((((((((((((....))))))))))))))))).)))))))).)))))..

Structure

cu     a        A                 A 
  uggga uggcgagg AACCGUUACCAUUACUG G
  ||||| |||||||| |||||||||||||||||  
  acccu gucguucu uuggcaaugguaaugau U
ac     c        c                 U 

Annotation confidence Not enough data

Genome context

chr11: 78073170-78073241 [+]

Clustered miRNAs

2 other miRNAs are < 10 kb from mmu-mir-451a

Mature mmu-miR-451a

• Accession: MIMAT0001632
• Description: Mus musculus mmu-miR-451a mature miRNA
• Sequence: 17 - AAACCGUUACCAUUACUGAGUU - 38
• Evidence: experimental ; cloned [1-3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706


5. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267