miRBase entry: hsa-mir-409

Stem-loop hsa-mir-409


Accession
MI0001735
Symbol
HGNC: MIR409
Description
Homo sapiens hsa-mir-409 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR409 is a microRNA implicated in various biological processes and diseases, including its deregulation in gastrointestinal stromal tumors (GISTs), where it is expressed higher in intestinal compared to gastric tumors [PMC5796982]. It is part of the DLK1-DIO3 genomic region and belongs to cluster B of the microRNA cluster [PMC7308478]. MIR409's downregulation has been associated with the early onset of fibrosis in livers co-infected with HCV and HIV, suggesting a role in extracellular matrix remodeling [PMC8869900]. It has been predicted to target genes such as SRY-box containing gene 6 (Sox6), which could have implications for various cellular functions [PMC4488424]. MIR409, along with other muscle-specific microRNAs, has been shown to induce induced cardiomyocytes (iCMs) from mouse cardiac fibroblasts, indicating its potential role in cardiac regeneration [PMC6679082]. Furthermore, MIR409's expression has been linked with traits such as weight and lean mass, suggesting its utility as a biomarker for weight loss [PMC5659802]. In pathological conditions like severe drug reactions (SJS/TEN) and pancreatic ductal adenocarcinoma (PDAC), MIR409's expression levels have been associated with disease progression and prognosis [PMC9027774], [PMC10057657].

Literature search
158 open access papers mention hsa-mir-409
(435 sentences)

Sequence

220211 reads, 463.0 reads per million, 171 experiments
ugguacucggggagAGGUUACCCGAGCAACUUUGCAUcuggacgacGAAUGUUGCUCGGUGAACCCCUuuucgguauca
((((((.(((((((.((((..((((((((((((((........).)))).)))))))))..)))).)))))))))))))

Structure
      u       A    AC         -    - AUc 
ugguac cggggag GGUU  CCGAGCAAC UUUG C   u
|||||| ||||||| ||||  ||||||||| |||| |    
acuaug gcuuuUC CCAA  GGCUCGUUG AAGc g   g
      -       C    GU         U    a cag 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr14: 101065300-101065378 [+]
Clustered miRNAs
10 other miRNAs are < 10 kb from hsa-mir-409
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-409 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-409-5p

Accession MIMAT0001638
Description Homo sapiens hsa-miR-409-5p mature miRNA
Sequence 15 - AGGUUACCCGAGCAACUUUGCAU - 37
Evidence experimental
cloned [1,3-4]
Database links
Predicted targets

Mature hsa-miR-409-3p

Accession MIMAT0001639
Description Homo sapiens hsa-miR-409-3p mature miRNA
Sequence 47 - GAAUGUUGCUCGGUGAACCCCU - 68
Evidence experimental
cloned [1,3-4], array-cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  3. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267