miRBase entry: gma-MIR167b

Stem-loop gma-MIR167b


Accession
MI0001778
Description
Glycine max gma-MIR167b precursor miRNA

Literature search
26 open access papers mention gma-MIR167b
(203 sentences)

Sequence


aagggucacaaaggaaaaagUGAAGCUGCCAGCAUGAUCUAgcuuugguuagugggagcgagagagugcuaacccucacuaggucaugcugugcuagccucacuccuuccuauuuggagac
....(((.((((((((..(((((.((((((((((((((((((....(((((((....((......)))))))))....))))))))))))).)).))).)))))..)))))..)))..)))

Structure
aagg   -a   --     aa     A   -  -             cuuu       ggga  ga 
    guc  caa  aggaa  agUGA GCU GC CAGCAUGAUCUAg    gguuagu    gc  g
    |||  |||  |||||  ||||| ||| || |||||||||||||    |||||||    ||   
    cag  guu  uccuu  ucacu cga cg gucguacuggauc    ccaaucg    ug  a
----   ag   ua     cc     c   u  u             acuc       ----  ag 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 14838068-14838188 [-]

Database links

Mature gma-miR167b

Accession MIMAT0001680
Description Glycine max gma-miR167b mature miRNA
Sequence 21 - UGAAGCUGCCAGCAUGAUCUA - 41
Evidence experimental
454 [1]

References

  1. Conservation and divergence of microRNA families in plants
    "Dezulian T, Palatnik JF, Huson DH, Weigel D"
    Genome Biol. (2005) 6:P13

  2. PubMed ID: 18402695
    Novel and nodulation-regulated microRNAs in soybean roots
    Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O
    BMC Genomics (2008) 9:160