WARNING: This summary was generated by AI. Dre-mir-20b, a microRNA investigated in zebrafish embryos, has been associated with increased mortality and developmental abnormalities when present at a concentration of 4 µM [PMC6834413]. The study revealed that embryos in the 4 µM dre-mir-20b group exhibited a significantly higher mortality rate and a lower survival rate compared to the negative control (NC) group and wild-type counterparts [PMC6834413]. Additionally, the expression levels of fibroblast growth factor 2 (FGF2) and growth factor receptor-bound protein 2 (GRB2) mRNA were notably reduced in the dre-mir-20b group, suggesting that dre-mir-20b may negatively regulate these genes [PMC6834413]. Morphological examination under an optical microscope identified abnormalities in retinal structure, particularly sparse and irregularly arranged photoreceptor cells within the dre-mir-20b group [PMC6834413'>PMC6834413'>PMC6834413]. Furthermore, these embryos displayed more pronounced overall morphological defects including significantly smaller eye volumes [PMC6834413]. Immunofluorescence assays corroborated these findings by showing decreased protein expression levels of FGF2 and GRB2 in the photoreceptor cell layer of embryos affected by dre-mir-20b when compared to controls [PMC6834413]. The study's methodology involved injecting 4 µM dre-mir-20b mimics into zebrafish at the single-cell stage for subsequent analysis at an incubation temperature of 28.5°C [PMC6834413].
gaguu u -ucCA UC G G ug a
ugucc ggcagu AAGUGC ACA UGCAG UAG cc
||||| |||||| |||||| ||| ||||| ||| || g
gcagg ccguua UUCACG UGU ACGUC Auc gg
cuucc - UGAAC UC A - ua u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0001778 |
| Description | Danio rerio dre-miR-20b-5p mature miRNA |
| Sequence | 20 - CAAAGUGCUCACAGUGCAGGUAG - 42 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0031939 |
| Description | Danio rerio dre-miR-20b-3p mature miRNA |
| Sequence | 56 - ACUGCAAUGUCUGCACUUCAAGU - 78 |
| Evidence | not_experimental |
| Database links |
|
|