Stem-loop mmu-mir-467a-1

Accession

MI0002402

Symbol

MGI: Mir467a-1

Description

Mus musculus mmu-mir-467a-1 precursor miRNA

Literature search

26 open access papers mention mmu-mir-467a-1
(106 sentences)

Sequence

78162 reads, 665 reads per million, 102 experiments

cugugugcgUAAGUGCCUGCAUGUAUAUGCGuguauauuuuaugCAUAUACAUACACACACCUACAcacacau
.((((((.(((.(((..((.(((((((((((((.......))))))))))))).))..))).))).)))))).

Structure

c      c   A   CC  C             ua 
 ugugug gUA GUG  UG AUGUAUAUGCGug  u
 |||||| ||| |||  || |||||||||||||  a
 acacac CAU CAC  AC UACAUAUACguau  u
u      A   C   AC  A             uu 

Annotation confidence High

Comments

The sequence of miR-467 is of low complexity. The sequence maps exactly to several genomic positions, and many more with 1 or 2 substitutions. Confidence in this miRNA might therefore be reduced.

Genome context

chr2: 10476346-10476418 [+]

Clustered miRNAs

30 other miRNAs are < 10 kb from mmu-mir-467a-1

Mature mmu-miR-467a-5p

• Accession: MIMAT0003409
• Description: Mus musculus mmu-miR-467a-5p mature miRNA
• Sequence: 10 - UAAGUGCCUGCAUGUAUAUGCG - 31
• Evidence: experimental ; Illumina [1]

Mature mmu-miR-467a-3p

• Accession: MIMAT0002108
• Description: Mus musculus mmu-miR-467a-3p mature miRNA
• Sequence: 45 - CAUAUACAUACACACACCUACA - 66
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 16582102
   The expression profile of microRNAs in mouse embryos
   "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
   "Nucleic Acids Res (2006) 34:1765-1771


5. PubMed ID: 15901636
   MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage
   "Yu Z, Raabe T, Hecht NB"
   "Biol Reprod (2005) 73:427-433