miRBase entry: ssc-mir-145

Stem-loop ssc-mir-145


Accession
MI0002417
Description
Sus scrofa ssc-mir-145 precursor miRNA

Literature search
24 open access papers mention ssc-mir-145
(65 sentences)

Sequence

10807 reads, 4593 reads per million, 14 experiments
caccuuguccucacgGUCCAGUUUUCCCAGGAAUCCCUUagaugcugagauggGGAUUCCUGGAAAUACUGUUCUugaggucaugg
..((.((.(((((.((..((((.((.((((((((((((.............)))))))))))).)).))))..))))))).)).))

Structure
ca  u  u     c  UC    U  C            Uagau 
  cc ug ccuca gG  CAGU UU CCAGGAAUCCCU     g
  || || ||||| ||  |||| || ||||||||||||     c
  gg ac ggagu UC  GUCA AA GGUCCUUAGGgg     u
--  u  u     -  UU    U  A            uagag 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr2: 157346127-157346212 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from ssc-mir-145
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ssc-miR-145-5p

Accession MIMAT0002123
Description Sus scrofa ssc-miR-145-5p mature miRNA
Sequence 16 - GUCCAGUUUUCCCAGGAAUCCCUU - 39
Evidence experimental
cloned [2,4], Illumina [3,5-6]

Mature ssc-miR-145-3p

Accession MIMAT0022919
Description Sus scrofa ssc-miR-145-3p mature miRNA
Sequence 54 - GGAUUCCUGGAAAUACUGUUCU - 75
Evidence experimental
Illumina [5]

References

  1. PubMed ID: 15885146
    Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing
    "Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L"
    "BMC Genomics (2005) 6:70

  2. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  3. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  4. PubMed ID: 18548309
    Identification and characterization of new microRNAs from pig
    "Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS"
    "Mamm Genome (2008) 19:570-580

  5. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  6. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100