Stem-loop ssc-mir-23a

Accession

MI0002427

Description

Sus scrofa ssc-mir-23a precursor miRNA

Literature search

29 open access papers mention ssc-mir-23a
(62 sentences)

Sequence

750 reads, 341 reads per million, 13 experiments

cggcugggguuccuggggaugggauuugcugccugucacaaAUCACAUUGCCAGGGAUUUCCaaucgacc
(((.((((((((((((.((((.((((((.((.....)))))))).)))).))))))).))))).)))...

Structure

---   c     -       g    g      c  c 
   cgg ugggg uuccugg gaug gauuug ug c
   ||| ||||| ||||||| |||| |||||| || u
   gcu aCCUU AGGGACC UUAC CUAaac ac g
cca   a     U       G    A      -  u 

Annotation confidence Not enough data

Genome context

chr2: 65581838-65581907 [+]

Clustered miRNAs

2 other miRNAs are < 10 kb from ssc-mir-23a

Mature ssc-miR-23a

• Accession: MIMAT0002133
• Description: Sus scrofa ssc-miR-23a mature miRNA
• Sequence: 42 - AUCACAUUGCCAGGGAUUUCC - 62
• Evidence: experimental ; cloned [2,4], Illumina [3,5-6]

References

1. PubMed ID: 15885146
   Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing
   "Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L"
   "BMC Genomics (2005) 6:70


2. PubMed ID: 19917043
   MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
   "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
   "Anim Genet (2010) 41:159-168


3. PubMed ID: 20180025
   Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
   "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
   "Mol Biol Rep (2010) 37:3567-3574


4. PubMed ID: 18548309
   Identification and characterization of new microRNAs from pig
   "Kim J, Cho IS, Hong JS, Choi YK, Kim H, Lee YS"
   "Mamm Genome (2008) 19:570-580


5. PubMed ID: 21312241
   MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
   "Li G, Li Y, Li X, Ning X, Li M, Yang G"
   "J Cell Biochem (2011) 112:1318-1328


6. PubMed ID: 24499489
   Exploration of microRNAs in porcine milk exosomes
   Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
   BMC Genomics (2014) 15:100