miRBase entry: ssc-mir-27a

Stem-loop ssc-mir-27a


Accession
MI0002442
Description
Sus scrofa ssc-mir-27a precursor miRNA

Literature search
62 open access papers mention ssc-mir-27a
(139 sentences)

Sequence

21341994 reads, 13856.0 reads per million, 214 experiments
uggccuggggagcAGGGCUUAGCUGCUUGUGAGCAgguccacagcaagucgugUUCACAGUGGCUAAGUUCCGCccccugga
...((.((((.((.(((((((((((((.(((((((.(.(........).).)))))))))))))))))))).)))))).)).

Structure
ugg  u    a  A             U       g u cac 
   cc gggg gc GGGCUUAGCUGCU GUGAGCA g c   a
   || |||| || ||||||||||||| ||||||| | |    
   gg cccc CG CUUGAAUCGGUGA CACUUgu c g   g
--a  u    -  C             -       g u aac 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr2: 65582015-65582096 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from ssc-mir-27a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ssc-miR-27a-5p

Accession MIMAT0052570
Description Sus scrofa ssc-miR-27a-5p mature miRNA
Sequence 14 - AGGGCUUAGCUGCUUGUGAGCA - 35
Evidence experimental
cloned [2], Illumina [3-4]

Mature ssc-miR-27a-3p

Accession MIMAT0002148
Description Sus scrofa ssc-miR-27a-3p mature miRNA
Sequence 54 - UUCACAGUGGCUAAGUUCCGC - 74
Evidence experimental
cloned [2], Illumina [3-4]

References

  1. PubMed ID: 15885146
    Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing
    "Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L"
    "BMC Genomics (2005) 6:70

  2. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  3. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  4. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100