miRBase entry: ssc-let-7c

Stem-loop ssc-let-7c


Accession
MI0002445
Description
Sus scrofa ssc-let-7c precursor miRNA

Literature search
42 open access papers mention ssc-let-7c
(149 sentences)

Sequence

1007 reads, 389 reads per million, 15 experiments
ugugugcauccggguUGAGGUAGUAGGUUGUAUGGUUuagaguuacaccgugggaguuaacuguacaaccuucuagcuuuccuuggagcacacu
.((((((.((((((..(((.(((.(((((((((((((.....((((...)))).....))))))))))))).))).)))..)))))))))))).

Structure
u      a      uU   G   U             uagag    a 
 gugugc uccggg  GAG UAG AGGUUGUAUGGUU     uuac  
 |||||| ||||||  ||| ||| |||||||||||||     |||| c
 cacacg agguuc  uuc auc uccaacaugucaa     ggug  
u      -      cu   g   u             uugag    c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr13: 191559336-191559429 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from ssc-let-7c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ssc-let-7c

Accession MIMAT0002151
Description Sus scrofa ssc-let-7c mature miRNA
Sequence 16 - UGAGGUAGUAGGUUGUAUGGUU - 37
Evidence experimental
454 [2], Illumina [3,5-6], cloned [4]

References

  1. PubMed ID: 15885146
    Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing
    "Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L"
    "BMC Genomics (2005) 6:70

  2. PubMed ID: 19196471
    Cloning, characterization and expression analysis of porcine microRNAs
    Reddy AM, Zheng Y, Jagadeeswaran G, Macmil SL, Graham WB, Roe BA, Desilva U, Zhang W, Sunkar R
    BMC Genomics (2009) 10:65

  3. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  4. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  5. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  6. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100