miRBase entry: hsa-mir-410

Stem-loop hsa-mir-410


Accession
MI0002465
Symbol
HGNC: MIR410
Description
Homo sapiens hsa-mir-410 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR410 is a microRNA gene that has been implicated in the regulation of apoptosis in human pulmonary artery endothelial cells (hPAECs), as suggested by research indicating that NAMPT, a protein known to promote resistance to apoptosis, is associated with the function of MIR410 [PMC6616369]. Additionally, MIR410, along with MIR155, has been identified as playing a role in glucose metabolism [PMC8620086]. This connection to both apoptosis and glucose metabolism suggests that MIR410 may have multifaceted roles within cellular processes and could be a significant factor in the regulation of cellular homeostasis and disease states.

Literature search
150 open access papers mention hsa-mir-410
(1037 sentences)

Sequence

53414 reads, 220.0 reads per million, 111 experiments
gguaccugagaagAGGUUGUCUGUGAUGAGUUCGcuuuuauuaaugacgAAUAUAACACAGAUGGCCUGUUuucaguacc
(((((.((((((.((((((((((((.((.((((((..........).))))).)).)))))))))))).)))))))))))

Structure
     c      g            A  A     - uuuu 
gguac ugagaa AGGUUGUCUGUG UG GUUCG c    a
||||| |||||| |||||||||||| || ||||| |     
ccaug acuuUU UCCGGUAGACAC AU UAAgc g    u
     -      G            A  A     a uaau 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101065912-101065991 [+]
Clustered miRNAs
9 other miRNAs are < 10 kb from hsa-mir-410
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-410 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-410-5p

Accession MIMAT0026558
Description Homo sapiens hsa-miR-410-5p mature miRNA
Sequence 14 - AGGUUGUCUGUGAUGAGUUCG - 34
Evidence experimental
Illumina [6]

Mature hsa-miR-410-3p

Accession MIMAT0002171
Description Homo sapiens hsa-miR-410-3p mature miRNA
Sequence 50 - AAUAUAACACAGAUGGCCUGUU - 71
Evidence experimental
array-cloned [2], cloned [3-5], Northern [3], Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854

  3. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  4. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  6. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45