Stem-loop hsa-mir-410

Accession

MI0002465

Symbol

HGNC: MIR410

Description

Homo sapiens hsa-mir-410 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR410 is a microRNA gene that has been implicated in the regulation of apoptosis in human pulmonary artery endothelial cells (hPAECs), as suggested by research indicating that NAMPT, a protein known to promote resistance to apoptosis, is associated with the function of MIR410 [PMC6616369]. Additionally, MIR410, along with MIR155, has been identified as playing a role in glucose metabolism [PMC8620086]. This connection to both apoptosis and glucose metabolism suggests that MIR410 may have multifaceted roles within cellular processes and could be a significant factor in the regulation of cellular homeostasis and disease states.

Literature search

59 open access papers mention hsa-mir-410
(631 sentences)

Sequence

2796 reads, 10 reads per million, 69 experiments

gguaccugagaagAGGUUGUCUGUGAUGAGUUCGcuuuuauuaaugacgAAUAUAACACAGAUGGCCUGUuuucaguacc
(((((.((((((.((((((((((((.((.((((((..........).))))).)).)))))))))))).)))))))))))

Structure

     c      g            A  A     - uuuu 
gguac ugagaa AGGUUGUCUGUG UG GUUCG c    a
||||| |||||| |||||||||||| || ||||| |     
ccaug acuuuU UCCGGUAGACAC AU UAAgc g    u
     -      G            A  A     a uaau 

Annotation confidence High

Genome context

chr14: 101065912-101065991 [+]

Clustered miRNAs

9 other miRNAs are < 10 kb from hsa-mir-410

Disease association

hsa-mir-410 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-410-3p

• Accession: MIMAT0002171
• Description: Homo sapiens hsa-miR-410-3p mature miRNA
• Sequence: 50 - AAUAUAACACAGAUGGCCUGU - 70
• Evidence: experimental ; array-cloned [2], cloned [3-5], Northern [3], Illumina [6]

Mature hsa-miR-410-5p

• Accession: MIMAT0026558
• Description: Homo sapiens hsa-miR-410-5p mature miRNA
• Sequence: 14 - AGGUUGUCUGUGAUGAGUUCG - 34
• Evidence: experimental ; Illumina [6]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15978578
   Identification of human fetal liver miRNAs by a novel method
   "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
   "FEBS Lett (2005) 579:3849-3854


3. PubMed ID: 15891114
   Clustering and conservation patterns of human microRNAs
   "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
   "Nucleic Acids Res (2005) 33:2697-2706


4. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770


5. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267


6. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45