WARNING: This summary was generated by AI. Hsa-mir-484 is a microRNA known for its stable expression in plasma and has been identified as having limited intra-group variability in expression, making it a reliable candidate for studies involving miRNA profiling [PMC8533962]. In a cohort study, hsa-mir-484 was found to be significantly differentially expressed between multiple sclerosis (MS) patients and healthy individuals, suggesting its potential role as a biomarker for this disease [PMC10062329]. Further research involving an in vitro model with a heterozygous deletion of MIR484 has functionally validated the impact of rare copy number variations (CNVs) on the expression of hsa-mir-484 and the dysregulation of its target genes [PMC9587983]. The statement regarding hsa-mir-484 being a predicted target of hsa-miR-1307-3p is incorrect and should be omitted. The structural characteristics of hsa-mir-484 have been compared with its bovine counterpart, bta-miR-484, highlighting similarities in their hairpin structures which are essential for their function [PMC2254598].
a ----uc CUCA C AU -c a gcc gUCAGG GUC CCUCCCG aaa cccu a ||| |||||| ||| ||||||| ||| |||| cgg cggucc cag ggggggc uuu ggga a g uuuuuu ---- u cc ca u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002174 |
| Description | Homo sapiens hsa-miR-484 mature miRNA |
| Sequence | 8 - UCAGGCUCAGUCCCCUCCCGAU - 29 |
| Evidence |
experimental
cloned [1-3], Northern [1] |
| Database links |
|
| Predicted targets |
|
|