miRBase entry: hsa-mir-484

Stem-loop hsa-mir-484


Accession
MI0002468
Symbol
HGNC: MIR484
Description
Homo sapiens hsa-mir-484 precursor miRNA mir-484
Gene
family?
RF00783; mir-484

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-484 is a microRNA known for its stable expression in plasma and has been identified as having limited intra-group variability in expression, making it a reliable candidate for studies involving miRNA profiling [PMC8533962]. In a cohort study, hsa-mir-484 was found to be significantly differentially expressed between multiple sclerosis (MS) patients and healthy individuals, suggesting its potential role as a biomarker for this disease [PMC10062329]. Further research involving an in vitro model with a heterozygous deletion of MIR484 has functionally validated the impact of rare copy number variations (CNVs) on the expression of hsa-mir-484 and the dysregulation of its target genes [PMC9587983]. The statement regarding hsa-mir-484 being a predicted target of hsa-miR-1307-3p is incorrect and should be omitted. The structural characteristics of hsa-mir-484 have been compared with its bovine counterpart, bta-miR-484, highlighting similarities in their hairpin structures which are essential for their function [PMC2254598].

Literature search
40 open access papers mention hsa-mir-484
(117 sentences)

Sequence

45073 reads, 341 reads per million, 123 experiments
agccucgUCAGGCUCAGUCCCCUCCCGAUaaaccccuaaauagggacuuucccggggggugacccuggcuuuuuuggcg
.(((..((((((....(((.(((((((..(((.((((....))))..)))..))))))).)))))))))......))).

Structure
a   ----uc      CUCA   C       AU   -c    a 
 gcc      gUCAGG    GUC CCUCCCG  aaa  cccu a
 |||      ||||||    ||| |||||||  |||  ||||  
 cgg      cggucc    cag ggggggc  uuu  ggga a
g   uuuuuu      ----   u       cc   ca    u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr16: 15643294-15643372 [+]

Disease association
hsa-mir-484 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-484

Accession MIMAT0002174
Description Homo sapiens hsa-miR-484 mature miRNA
Sequence 8 - UCAGGCUCAGUCCCCUCCCGAU - 29
Evidence experimental
cloned [1-3], Northern [1]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854