miRBase entry: hsa-mir-202

Stem-loop hsa-mir-202


Accession
MI0003130
Symbol
HGNC: MIR202
Description
Homo sapiens hsa-mir-202 precursor miRNA mir-202
Gene
family?
RF00705; mir-202

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR202 is a microRNA implicated in various biological processes and diseases, including breast cancer (BC), where it has been proposed as a biomarker in multiple independent clinical studies [PMC9967215]. It is located at the end of the chromosome in eutherian genomes, with its gene order conserved across different species, although with some variations [PMC3706607]. In knockout (KO) and knock-in (KI) mouse models, MIR202 has been observed to decrease in abundance [PMC10001410]], suggesting its involvement in gene regulation under these conditions. MIR202 has also been associated with polymorphisms in B-cell acute lymphoblastic leukemia patients [PMC7421781] and is notably duplicated at chromosome 10q26 alongside other genes [PMC4147387]. It has been identified as a potential regulator of genes related to aging and angiogenesis, such as HAS2 [PMC4168028], and its expression is notably increased alongside its host gene in non-obstructive azoospermia (NOA) cases of spermatogonial arrest [PMC8800634]. Furthermore, MIR202 expression influences the incorporation of tumor-suppressive miRNAs into exosomes within the ceramide pathway [PMC8722109], highlighting its role in intercellular communication. In esophageal cancer cell lines, overexpression of MIR202 significantly affects autophagy-related processes [PMC5302951], indicating its potential role in cancer biology.

Literature search
178 open access papers mention hsa-mir-202
(606 sentences)

Sequence

32844 reads, 91.0 reads per million, 111 experiments
cgccucagagccgcccgccguuccuuuUUCCUAUGCAUAUACUUCUUUgaggaucuggccuaaAGAGGUAUAGGGCAUGGGAAAacggggcggucggguccuccccagcg
(((....(((..((((((((((((.(((((((((((.(((((((((((.(((......))))))))))))))..))))))))))).))))))).))))).)))....)))

Structure
   cuca   cc     -       u           -A           g   au 
cgc    gag  gcccg ccguucc uuUUCCUAUGC  UAUACUUCUUU agg  c
|||    |||  ||||| ||||||| |||||||||||  ||||||||||| |||   
gcg    cuc  ugggc ggcgggg aAAAGGGUACG  AUAUGGAGAaa ucc  u
   accc   -c     u       c           GG           -   gg 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr10: 133247511-133247620 [-]

Disease association
hsa-mir-202 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-202-5p

Accession MIMAT0002810
Description Homo sapiens hsa-miR-202-5p mature miRNA
Sequence 28 - UUCCUAUGCAUAUACUUCUUU - 48
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-202-3p

Accession MIMAT0002811
Description Homo sapiens hsa-miR-202-3p mature miRNA
Sequence 64 - AGAGGUAUAGGGCAUGGGAAA - 84
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770