MIR202 is a microRNA that has been studied in various contexts. It has been found to have both upregulated and downregulated expression in different studies [PMC9967215]. MIR202 has been proposed as a potential biomarker for breast cancer, as it has been identified in multiple independent clinical studies [PMC9967215]. In eutherian genomes, the MIR202 gene is found closest to the end of the chromosome [PMC3706607]. In knockout (KO) and knock-in (KI) mice, MIR202 expression levels have been shown to decrease [PMC10001410]. MIR202 is downregulated in both KO and KI mice, suggesting its potential role as a regulator [PMC10001410]. Polymorphisms in the MIR202 gene have also been analyzed in B-cell acute lymphoblastic leukemia patients [PMC7421781]. Additionally, MIR202 has been found to be a potential regulator of the hyaluronan synthase-encoding gene HAS2, which is associated with aging and angiogenesis [PMC4168028]. The expression of MIR202 has also been studied in wound healing and esophageal cancer cells [PMC8575992] [PMC5302951]. It is worth noting that miR-181c, miR-19a, miR-503, and miR-105 are involved in brain metastasis of breast cancer but are not directly related to MIR202.
cuca cc - u -A G au cgc gag gcccg ccguucc uuUUCCUAUGC UAUACUUCUUU agg c ||| ||| ||||| ||||||| ||||||||||| ||||||||||| ||| gcg cuc ugggc ggcgggg aaAAGGGUACG AUAUGGAGAaa ucc u accc -c u c GG - gg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002810 |
Description | Homo sapiens hsa-miR-202-5p mature miRNA |
Sequence | 28 - UUCCUAUGCAUAUACUUCUUUG - 49 |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0002811 |
Description | Homo sapiens hsa-miR-202-3p mature miRNA |
Sequence | 64 - AGAGGUAUAGGGCAUGGGAA - 83 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|