Accession | MIMAT0002810 |
Description | hsa-miR-202-5p mature miRNA |
Hairpins | |
Sequence | UUCCUAUGCAUAUACUUCUUUG |
Evidence |
experimental
array-cloned [1], cloned [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010719 negative regulation of epithelial to mesenchymal transition |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:28373289 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28373289 | has_input UniProtKB:P36897 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28373289 | has_input UniProtKB:P36897 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|