miRBase entry: hsa-mir-493

Stem-loop hsa-mir-493


Accession
MI0003132
Symbol
HGNC: MIR493
Description
Homo sapiens hsa-mir-493 precursor miRNA mir-493
Gene
family?
RF04100; mir-493

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR493 is a microRNA that has been identified as down-regulated in bladder cancer (BC) [PMC3828615], yet paradoxically, it is also reported as upregulated in various cancers [PMC9775527]. This microRNA has been implicated in significant biological processes, as the knockout of its target gene, Pcgf2, along with the targets of other miRNAs, has been associated with prenatal and postnatal growth retardation and lethality [PMC5886287]. Furthermore, MIR493 is considered one of the most influential miRNAs due to the severe defects observed upon deletion of its target genes [PMC5886287]. However, the statement that mutations in CNTN1 and SCNN1B, which are targets of MIR493, are linked to a phenotype resembling Temple syndrome is not supported by the provided reference [PMC5886287]. In a study confirming sequencing results related to the DLK1-DIO3 genomic region, MIR493 was one of four representative miRNAs selected for analysis [PMC7308478]. Additionally, MIR493 was among the most differentially expressed (DE) miRNAs identified in a genomic region associated with certain phenotypes in dogs according to an analysis comparing affected versus control groups [PMC8376273].

Literature search
86 open access papers mention hsa-mir-493
(424 sentences)

Sequence

26621 reads, 54.0 reads per million, 152 experiments
cuggccuccagggcuUUGUACAUGGUAGGCUUUCAUUcauucguuugcacauucggUGAAGGUCUACUGUGUGCCAGGcccugugccag
(((((...((((((((.((((((((((((((((((((.................)))))))))))))))))))).)))))))).)))))

Structure
     cuc        U                    cauucgu 
cuggc   cagggcuU GUACAUGGUAGGCUUUCAUU       u
|||||   |||||||| ||||||||||||||||||||       u
gaccg   gucccGGA CGUGUGUCAUCUGGAAGUgg       g
     --u        C                    cuuacac 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature miRNA sequences were named miR-493-5p and miR-493-3p in [1,2] and here. Landgraf et al. showed that the 3' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr14: 100869060-100869148 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-493
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-493 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-493-5p

Accession MIMAT0002813
Description Homo sapiens hsa-miR-493-5p mature miRNA
Sequence 16 - UUGUACAUGGUAGGCUUUCAUU - 37
Evidence experimental
array-cloned [1], cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-493-3p

Accession MIMAT0003161
Description Homo sapiens hsa-miR-493-3p mature miRNA
Sequence 57 - UGAAGGUCUACUGUGUGCCAGG - 78
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267