WARNING: This summary was generated by AI. MIR493 is a microRNA that has been identified as down-regulated in bladder cancer (BC) [PMC3828615], yet paradoxically, it is also reported as upregulated in various cancers [PMC9775527]. This microRNA has been implicated in significant biological processes, as the knockout of its target gene, Pcgf2, along with the targets of other miRNAs, has been associated with prenatal and postnatal growth retardation and lethality [PMC5886287]. Furthermore, MIR493 is considered one of the most influential miRNAs due to the severe defects observed upon deletion of its target genes [PMC5886287]. However, the statement that mutations in CNTN1 and SCNN1B, which are targets of MIR493, are linked to a phenotype resembling Temple syndrome is not supported by the provided reference [PMC5886287]. In a study confirming sequencing results related to the DLK1-DIO3 genomic region, MIR493 was one of four representative miRNAs selected for analysis [PMC7308478]. Additionally, MIR493 was among the most differentially expressed (DE) miRNAs identified in a genomic region associated with certain phenotypes in dogs according to an analysis comparing affected versus control groups [PMC8376273].
cuc U cauucgu
cuggc cagggcuU GUACAUGGUAGGCUUUCAUU u
||||| |||||||| |||||||||||||||||||| u
gaccg gucccGGA CGUGUGUCAUCUGGAAGUgg g
--u C cuuacac
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002813 |
| Description | Homo sapiens hsa-miR-493-5p mature miRNA |
| Sequence | 16 - UUGUACAUGGUAGGCUUUCAUU - 37 |
| Evidence |
experimental
array-cloned [1], cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0003161 |
| Description | Homo sapiens hsa-miR-493-3p mature miRNA |
| Sequence | 57 - UGAAGGUCUACUGUGUGCCAGG - 78 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
|