WARNING: This summary was generated by AI. MIR494 is an oncogenic microRNA that is upregulated in various cancers, indicating its potential role in cancer progression [PMC9775527]. It has been observed that the expression of MIR494 can lead to a reduction in cholesterol levels, which correlates with an increase in cell death and a heightened apoptotic response [PMC4722626]. This suggests that MIR494 may contribute to the reduction of cellular viability through mechanisms that are similar to cholesterol-disrupting agents like lovastatin [PMC4722626]. Additionally, MIR494 has been identified as a regulator of ATF3, while also sharing regulatory effects on JUN with MIR-501 [PMC4774345]. The regulatory influence of MIR494 on these transcription factors further underscores its role in cellular processes that may affect cancer cell survival and apoptosis [PMC4774345].
c G - C - Uuu
gauacu gaaggagAGGUU UCCGUGU UGU UUC UC a
|||||| |||||||||||| ||||||| ||| ||| || u
cuauga uuuuuuCUCCAA GGGCACA ACA AAG ag u
- A U - U uau
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002816 |
| Description | Homo sapiens hsa-miR-494-3p mature miRNA |
| Sequence | 48 - UGAAACAUACACGGGAAACCUC - 69 |
| Evidence |
experimental
array-cloned [1], cloned [2-3], Illumina [4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026607 |
| Description | Homo sapiens hsa-miR-494-5p mature miRNA |
| Sequence | 15 - AGGUUGUCCGUGUUGUCUUCUCU - 37 |
| Evidence |
experimental
Illumina [4] |
|