Stem-loop hsa-mir-494

Accession

MI0003134

Symbol

HGNC: MIR494

Description

Homo sapiens hsa-mir-494 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

WARNING: This summary was generated by AI. MIR494 is an oncogenic microRNA that is upregulated in various cancers, indicating its potential role in cancer progression [PMC9775527]. It has been observed that the expression of MIR494 can lead to a reduction in cholesterol levels, which correlates with an increase in cell death and a heightened apoptotic response [PMC4722626]. This suggests that MIR494 may contribute to the reduction of cellular viability through mechanisms that are similar to cholesterol-disrupting agents like lovastatin [PMC4722626]. Additionally, MIR494 has been identified as a regulator of ATF3, while also sharing regulatory effects on JUN with MIR-501 [PMC4774345]. The regulatory influence of MIR494 on these transcription factors further underscores its role in cellular processes that may affect cancer cell survival and apoptosis [PMC4774345].

Literature search

386 open access papers mention hsa-mir-494
(1866 sentences)

Sequence

9374 reads, 21.0 reads per million, 135 experiments

gauacucgaaggagAGGUUGUCCGUGUUGUCUUCUCUuuauuuaugaUGAAACAUACACGGGAAACCUCuuuuuuaguauc
((((((.((((((((((((.((((((((((.(((((.........)).)))))).))))))).))))))))))))))))))

Structure

      c            G       -   C   -  Uuu 
gauacu gaaggagAGGUU UCCGUGU UGU UUC UC   a
|||||| |||||||||||| ||||||| ||| ||| ||   u
cuauga uuuuuuCUCCAA GGGCACA ACA AAG ag   u
      -            A       U   -   U  uau 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr14: 101029634-101029714 [+]

Clustered miRNAs

13 other miRNAs are < 10 kb from hsa-mir-494

Disease association

hsa-mir-494 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-494-5p

• Accession: MIMAT0026607
• Description: Homo sapiens hsa-miR-494-5p mature miRNA
• Sequence: 15 - AGGUUGUCCGUGUUGUCUUCUCU - 37
• Evidence: experimental ; Illumina [4]

Mature hsa-miR-494-3p

• Accession: MIMAT0002816
• Description: Homo sapiens hsa-miR-494-3p mature miRNA
• Sequence: 48 - UGAAACAUACACGGGAAACCUC - 69
• Evidence: experimental ; array-cloned [1], cloned [2-3], Illumina [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770


3. PubMed ID: 16274478
   Identification of clustered microRNAs using an ab initio prediction method
   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
   BMC Bioinformatics (2005) 6:267


4. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45