miRBase entry: hsa-mir-494

Stem-loop hsa-mir-494


Accession
MI0003134
Symbol
HGNC: MIR494
Description
Homo sapiens hsa-mir-494 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR494 is an oncogenic microRNA that is upregulated in various cancers, indicating its potential role in cancer progression [PMC9775527]. It has been observed that the expression of MIR494 can lead to a reduction in cholesterol levels, which correlates with an increase in cell death and a heightened apoptotic response [PMC4722626]. This suggests that MIR494 may contribute to the reduction of cellular viability through mechanisms that are similar to cholesterol-disrupting agents like lovastatin [PMC4722626]. Additionally, MIR494 has been identified as a regulator of ATF3, while also sharing regulatory effects on JUN with MIR-501 [PMC4774345]. The regulatory influence of MIR494 on these transcription factors further underscores its role in cellular processes that may affect cancer cell survival and apoptosis [PMC4774345].

Literature search
149 open access papers mention hsa-mir-494
(1211 sentences)

Sequence

3110 reads, 12 reads per million, 99 experiments
gauacucgaaggagAGGUUGUCCGUGUUGUCUUCUCUuuauuuaugaUGAAACAUACACGGGAAACCUCuuuuuuaguauc
((((((.((((((((((((.((((((((((.(((((.........)).)))))).))))))).))))))))))))))))))

Structure
      c            G       -   C   -  Uuu 
gauacu gaaggagAGGUU UCCGUGU UGU UUC UC   a
|||||| |||||||||||| ||||||| ||| ||| ||   u
cuauga uuuuuuCUCCAA GGGCACA ACA AAG ag   u
      -            A       U   -   U  uau 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr14: 101029634-101029714 [+]
Clustered miRNAs
12 other miRNAs are < 10 kb from hsa-mir-494
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-494 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-494-3p

Accession MIMAT0002816
Description Homo sapiens hsa-miR-494-3p mature miRNA
Sequence 48 - UGAAACAUACACGGGAAACCUC - 69
Evidence experimental
array-cloned [1], cloned [2-3], Illumina [4]
Database links
Predicted targets

Mature hsa-miR-494-5p

Accession MIMAT0026607
Description Homo sapiens hsa-miR-494-5p mature miRNA
Sequence 15 - AGGUUGUCCGUGUUGUCUUCUCU - 37
Evidence experimental
Illumina [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  4. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45