miRBase entry: hsa-mir-517a

Stem-loop hsa-mir-517a


Accession
MI0003161
Symbol
HGNC: MIR517A
Description
Homo sapiens hsa-mir-517a precursor miRNA mir-515
Gene
family?
RF00639; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR517A is a placenta-specific microRNA belonging to the C19MC cluster, predominantly expressed in chorionic plate mesenchymal stem cells (CP-MSCs) and chorionic villi mesenchymal stem cells (CV-MSCs), with minimal or no expression in decidua basalis mesenchymal stem cells (DB-MSCs), Wharton's jelly mesenchymal stem cells (WJ-MSCs), and umbilical cord blood mesenchymal stem cells (UCB-MSCs) [PMC5388876]. This microRNA is maternally derived, found in the mother's plasma, and is known to be cleared from circulation shortly after childbirth [PMC7468461]. MIR517A has been implicated in gene regulation as it is subject to copy number variations (CNVs) that can affect its expression and that of its target genes [PMC3938728]. Synthesized by the syncytiotrophoblast, MIR517A can be packaged into exosomes for release, indicating its potential role in cell-to-cell communication [PMC7465902]. Despite its specific expression profile, no significant differences were found in MIR517A levels between patients with preeclampsia and controls, suggesting that C19MC miRNAs like MIR517A are not markedly altered in this condition [PMC4540200]. Additionally, MIR517A has been detected alongside other C19MC miRNAs in studies of breast invasive carcinoma and has been associated with both stem cell biology and tumorigenesis [PMC6193703; PMC8508841].. However, it was observed to have little or no RNA expression levels that could influence pathological subtyping of patients [PMC9623263].

Literature search
52 open access papers mention hsa-mir-517a
(226 sentences)

Sequence

263 reads, 3.0 reads per million, 30 experiments
ucucaggcagugacCCUCUAGAUGGAAGCACUGUCUguuguauaaaagaaaagAUCGUGCAUCCCUUUAGAGUGUuacuguuugaga
((((((((((((((.(((((((.(((.((((.((((...............)))).)))).))).))))))).))))))))))))))

Structure
              C       U   A    U    guugua 
ucucaggcagugac CUCUAGA GGA GCAC GUCU      u
|||||||||||||| ||||||| ||| |||| ||||      a
agaguuugucauUG GAGAUUU CCU CGUG UAga      a
              U       C   A    C    aaagaa 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr19: 53712268-53712354 [+]
Clustered miRNAs
10 other miRNAs are < 10 kb from hsa-mir-517a
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-517a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-517-5p

Accession MIMAT0002851
Description Homo sapiens hsa-miR-517-5p mature miRNA
Sequence 15 - CCUCUAGAUGGAAGCACUGUCU - 36
Evidence experimental
array-cloned [1]

Mature hsa-miR-517a-3p

Accession MIMAT0002852
Description Homo sapiens hsa-miR-517a-3p mature miRNA
Sequence 54 - AUCGUGCAUCCCUUUAGAGUGU - 75
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770