WARNING: This summary was generated by AI. MIR517A is a placenta-specific microRNA belonging to the C19MC cluster, predominantly expressed in chorionic plate mesenchymal stem cells (CP-MSCs) and chorionic villi mesenchymal stem cells (CV-MSCs), with minimal or no expression in decidua basalis mesenchymal stem cells (DB-MSCs), Wharton's jelly mesenchymal stem cells (WJ-MSCs), and umbilical cord blood mesenchymal stem cells (UCB-MSCs) [PMC5388876]. This microRNA is maternally derived, found in the mother's plasma, and is known to be cleared from circulation shortly after childbirth [PMC7468461]. MIR517A has been implicated in gene regulation as it is subject to copy number variations (CNVs) that can affect its expression and that of its target genes [PMC3938728]. Synthesized by the syncytiotrophoblast, MIR517A can be packaged into exosomes for release, indicating its potential role in cell-to-cell communication [PMC7465902]. Despite its specific expression profile, no significant differences were found in MIR517A levels between patients with preeclampsia and controls, suggesting that C19MC miRNAs like MIR517A are not markedly altered in this condition [PMC4540200]. Additionally, MIR517A has been detected alongside other C19MC miRNAs in studies of breast invasive carcinoma and has been associated with both stem cell biology and tumorigenesis [PMC6193703; PMC8508841].. However, it was observed to have little or no RNA expression levels that could influence pathological subtyping of patients [PMC9623263].
C U A U guugua
ucucaggcagugac CUCUAGA GGA GCAC GUCU u
|||||||||||||| ||||||| ||| |||| |||| a
agaguuugucauUG GAGAUUU CCU CGUG UAga a
U C A C aaagaa
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002851 |
| Description | Homo sapiens hsa-miR-517-5p mature miRNA |
| Sequence | 15 - CCUCUAGAUGGAAGCACUGUCU - 36 |
| Evidence |
experimental
array-cloned [1] |
| Accession | MIMAT0002852 |
| Description | Homo sapiens hsa-miR-517a-3p mature miRNA |
| Sequence | 54 - AUCGUGCAUCCCUUUAGAGUGU - 75 |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
|