miRBase entry: hsa-mir-522

Stem-loop hsa-mir-522


Accession
MI0003177
Symbol
HGNC: MIR522
Description
Homo sapiens hsa-mir-522 precursor miRNA mir-515
Gene
family?
RF00639; mir-515

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-522 is a microRNA (miRNA) that is part of the hsa-mir-519a cluster, which may be co-regulated as a unit, as suggested by the expression patterns observed in the TLDA platform analysis [PMC4424562]. This miRNA has been identified as having significantly overrepresented targets in MCF7 cells, indicating its potential role as an ID-miR [PMC4401570]. Moreover, hsa-mir-522 has been implicated in allele-specific targeting of the FXN gene, with certain variations creating novel target sites for this miRNA [PMC3559822]. This targeting is part of a broader context where hsa-mir-522 is one among several miRNAs that have been associated with variations in the FRDA-3′-UTR [PMC3559822]. Additionally, hsa-mir-522 has been listed among other miRNAs that have been studied for their role in tumor cell proliferation according to several open access papers cataloged in the miRBase dataset [PMC7366700].

Literature search
16 open access papers mention hsa-mir-522
(141 sentences)

Sequence

137 reads, 16 reads per million, 19 experiments
ucucaggcuguguccCUCUAGAGGGAAGCGCUUUCUGuugucugaaagaaaagAAAAUGGUUCCCUUUAGAGUGUuacgcuuugaga
((((((((.(((.(.((((((((((((.((.(((((....(((...)))..))))).)).)))))))))))).).))))).))))))

Structure
      -  u   u c            G  C     Guug   g 
ucucag gc gug c CUCUAGAGGGAA CG UUUCU    ucu  
|||||| || ||| | |||||||||||| || |||||    ||| a
agaguu cg cau G GAGAUUUCCCUU GU AAAga    aga  
      u  -   U U            G  A     --aa   a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr19: 53751211-53751297 [+]
Clustered miRNAs
8 other miRNAs are < 10 kb from hsa-mir-522
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-522 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-522-5p

Accession MIMAT0005451
Description Homo sapiens hsa-miR-522-5p mature miRNA
Sequence 16 - CUCUAGAGGGAAGCGCUUUCUG - 37
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-522-3p

Accession MIMAT0002868
Description Homo sapiens hsa-miR-522-3p mature miRNA
Sequence 54 - AAAAUGGUUCCCUUUAGAGUGU - 75
Evidence experimental
array-cloned [1], cloned [2-3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770