Hsa-mir-522 is a microRNA (miRNA) that is part of the hsa-mir-519a cluster, which may be co-regulated as a unit, as suggested by the expression patterns observed in the TLDA platform analysis [PMC4424562]. This miRNA has been identified as having significantly overrepresented targets in MCF7 cells, indicating its potential role as an ID-miR [PMC4401570]. Moreover, hsa-mir-522 has been implicated in allele-specific targeting of the FXN gene, with certain variations creating novel target sites for this miRNA [PMC3559822]. This targeting is part of a broader context where hsa-mir-522 is one among several miRNAs that have been associated with variations in the FRDA-3′-UTR [PMC3559822]. Additionally, hsa-mir-522 has been listed among other miRNAs that have been studied for their role in tumor cell proliferation according to several open access papers cataloged in the miRBase dataset [PMC7366700].
- u u c G C Guug g
ucucag gc gug c CUCUAGAGGGAA CG UUUCU ucu
|||||| || ||| | |||||||||||| || ||||| ||| a
agaguu cg cau G GAGAUUUCCCUU GU AAAga aga
u - U U G A --aa a
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005451 |
| Description | Homo sapiens hsa-miR-522-5p mature miRNA |
| Sequence | 16 - CUCUAGAGGGAAGCGCUUUCUG - 37 |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0002868 |
| Description | Homo sapiens hsa-miR-522-3p mature miRNA |
| Sequence | 54 - AAAAUGGUUCCCUUUAGAGUGU - 75 |
| Evidence |
experimental
array-cloned [1], cloned [2-3] |
|