MIR503 is a microRNA that has been identified as having a significant role in cellular processes, as evidenced by its consistent up- or downregulation across all passages in a study of pHPL-ASC gene expression profiles [PMC6694630]. This microRNA, along with others, is part of a unique gene expression signature that is passage-specific, indicating its potential importance in cellular aging or response to culture conditions [PMC6694630]. Furthermore, MIR503 has been found to be significantly downregulated in tumor samples from esophageal squamous cell carcinoma (ESCC) patients when compared to adjacent non-tumorous tissues from the same patients, with this decrease observed in 83% of the cases studied [PMC5487524]. This suggests that MIR503 may play a role in the tumorigenesis of ESCC or could potentially serve as a biomarker for this type of cancer [PMC5487524]. Additionally, MIR503 is part of the 3′ fragment along with mir351 when mir322 is cleaved; this could influence the biological functions and fate of these microRNA fragments [PMC4057207]. The study of MIR503 and its associated gene expression could provide valuable insights into cancer biology and potential therapeutic targets.
A U G Gu a ugcccU GCAGCGGGAACAGU CU CA gagcg u |||||| |||||||||||||| || || ||||| c augGGA CGUCGCCUUUGUUA GG Gu cucgu g C U G -- g
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0002874 |
Description | Homo sapiens hsa-miR-503-5p mature miRNA |
Sequence | 6 - UAGCAGCGGGAACAGUUCUGCAG - 28 |
Evidence |
experimental
array-cloned [1], cloned [2-3], SOLiD [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0022925 |
Description | Homo sapiens hsa-miR-503-3p mature miRNA |
Sequence | 46 - GGGGUAUUGUUUCCGCUGCCAGG - 68 |
Evidence |
experimental
SOLiD [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|