miRBase entry: hsa-mir-505

Stem-loop hsa-mir-505


Accession
MI0003190
Symbol
HGNC: MIR505
Description
Homo sapiens hsa-mir-505 precursor miRNA mir-505
Gene
family?
RF00781; mir-505

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR505 is a microRNA that has been identified as a potential biomarker in various biological contexts and diseases [PMC9918015]. It is normalized to U6 and β-actin expression using the 2−ΔΔCT method [PMC6352865]. In the context of Parkinson's disease, MIR505 is significantly down-regulated in cerebrospinal fluid and brain tissue of patients [PMC6115491]. It has been observed to increase in the ovaries of females exposed to chlorpyrifos, suggesting a role in ovarian response to environmental toxins [PMC9918015]. MIR505 has also been proposed as a marker of ovarian aging, with its expression being induced while anti-Müllerian hormone (AMH) mRNA is reduced [PMC9918015]. In developmental biology, MIR505 can inhibit neural tube formation and cell growth through its interaction with various growth factors and signaling pathways [PMC7040864]. Its altered expression could be implicated in neural tube defects such as spina bifida, potentially through its interaction with SOX3 or independently by targeting specific genes involved in developmental pathways [PMC7040864]. Additionally, MIR505's expression can be modulated by factors such as cisplatin resistance via the Wnt/β-catenin pathway in cancer contexts [PMC9331520], and it has been identified upstream of genes like ATP11C, suggesting regulatory roles within intronic regions of other genes' transcripts [PMC4561498].

Literature search
33 open access papers mention hsa-mir-505
(194 sentences)

Sequence

22819 reads, 106 reads per million, 156 experiments
gaugcacccaguggGGGAGCCAGGAAGUAUUGAUGUuucugccaguuuagCGUCAACACUUGCUGGUUUCCUcucuggagcauc
(((((..((((.(((((((((((.((((.((((((((...........)))))))).)))).))))))))))).)))).)))))

Structure
     ac    u           G    A        ucug 
gaugc  ccag ggGGGAGCCAG AAGU UUGAUGUu    c
|||||  |||| ||||||||||| |||| ||||||||    c
cuacg  gguc cUCCUUUGGUC UUCA AACUGCga    a
     -a    u           G    C        uuug 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chrX: 139924148-139924231 [-]

Disease association
hsa-mir-505 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-505-5p

Accession MIMAT0004776
Description Homo sapiens hsa-miR-505-5p mature miRNA
Sequence 15 - GGGAGCCAGGAAGUAUUGAUGU - 36
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-505-3p

Accession MIMAT0002876
Description Homo sapiens hsa-miR-505-3p mature miRNA
Sequence 51 - CGUCAACACUUGCUGGUUUCCU - 72
Evidence experimental
array-cloned [1], cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770