miRBase entry: hsa-mir-508

Stem-loop hsa-mir-508


Accession
MI0003195
Symbol
HGNC: MIR508
Description
Homo sapiens hsa-mir-508 precursor miRNA mir-507
Gene
family?
RF04282; mir-507

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR508 is a microRNA (miRNA) that plays a significant role in enhancing plant tolerance to salt stress and nitrogen (N) starvation in creeping bentgrass [PMC5916090]. This miRNA operates by modulating the transcription of genes such as AsAAO and AsCBP1, which are involved in maintaining water retention, cell membrane integrity, chlorophyll content, potassium homeostasis, and the activities of enzymes like CATALASE and ASCORBIC ACID OXIDASE [PMC5916090]. Additionally, MIR508 is implicated in the regulation of biomass production, N accumulation, chlorophyll synthesis, and NITRITE REDUCTASE activity under conditions of N starvation [PMC5916090]. MIR508 is part of a cluster known as the "fragile-X miRNA (FX-MIR)" cluster that includes other miRNAs such as miR506 and miR510; this cluster was identified through array-CGH analysis which revealed a deletion on Xq27.3 encompassing several genes and miRNAs [PMC9130735]. Despite its significant regulatory functions in plants, MIR508 was not detected in leaves or roots but was uniformly expressed in stems, internodes, and spikes [PMC2394755]. Furthermore, target prediction for MIR508 has been challenging due to limited sequence data available for wheat ESTs [PMC2394755].

Literature search
65 open access papers mention hsa-mir-508
(146 sentences)

Sequence

125566 reads, 599.0 reads per million, 66 experiments
ccaccuucagcugaguguagugcccUACUCCAGAGGGCGUCACUCAUGuaaacuaaaacaUGAUUGUAGCCUUUUGGAGUAGAguaauacacaucacguaacgcauauuuggugg
(((((....((((((((((.(((.((((((((((((((..((.((((((........)))))).))..)))))))))))))).))).))))).)))......))......)))))

Structure
     --uuca  ------   -     g   c              GU  C      aaa 
ccacc      gc      uga gugua ugc cUACUCCAGAGGGC  CA UCAUGu   c
|||||      ||      ||| ||||| ||| ||||||||||||||  || ||||||    
ggugg      cg      acu cacau aug GAUGAGGUUUUCCG  GU AGUaca   u
     uuuaua  caaugc   a     a   A              AU  U      aaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 147236913-147237027 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-508
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-508 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-508-5p

Accession MIMAT0004778
Description Homo sapiens hsa-miR-508-5p mature miRNA
Sequence 26 - UACUCCAGAGGGCGUCACUCAUG - 48
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-508-3p

Accession MIMAT0002880
Description Homo sapiens hsa-miR-508-3p mature miRNA
Sequence 61 - UGAUUGUAGCCUUUUGGAGUAGA - 83
Evidence experimental
array-cloned [1], cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770