miRBase entry: hsa-mir-532

Stem-loop hsa-mir-532


Accession
MI0003205
Symbol
HGNC: MIR532
Description
Homo sapiens hsa-mir-532 precursor miRNA mir-532
Gene
family?
RF04284; mir-532

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR532 is a microRNA that has been implicated in various cellular processes and diseases, including cancer. It was significantly up-regulated in a majority of HCC-post HCV positive patients, indicating a potential role in liver cancer pathogenesis [PMC3245605]. Interestingly, MIR532 has been shown to inhibit the invasiveness of parental tumor cells and is not regulated by TERT, suggesting its role as a tumor suppressor [PMC8253104]. It is located upstream of miR500A and acts as a negative regulator of TERT in ovarian cancer by decreasing cell proliferation and invasion capacity [PMC8253104]. MIR532's expression was not affected by TERT binding to the upstream region containing TBE sequences, which contrasts with miR500A that is regulated by TERT [PMC8253104]. In the context of ovarian cancer, MIR532 expression levels were correlated with overall survival outcomes for patients [PMC7359466]. Additionally, high levels of exosomal MIR532 were associated with favorable overall survival in acute myeloid leukemia (AML) patients, suggesting its potential as a prognostic biomarker [PMC7912829]. The promoter activity of MIR532 can be activated by the introduction of transcription factors such as TTF-1 but is not affected by DNA hypermethylation; this indicates other regulatory mechanisms at play for this microRNA's expression [PMC5497805].

Literature search
183 open access papers mention hsa-mir-532
(505 sentences)

Sequence

326932 reads, 447.0 reads per million, 195 experiments
cgacuugcuuucucuccucCAUGCCUUGAGUGUAGGACCGUuggcaucuuaauuacCCUCCCACACCCAAGGCUUGCAgaagagcgagccu
......((((.((((.((.((.((((((.((((.(((..((.............))..))).)))).)))))).)).)).)))).))))..

Structure
cgacuu    u    c  c  U      A    A   CC  uggca 
      gcuu cucu cu CA GCCUUG GUGU GGA  GU     u
      |||| |||| || || |||||| |||| |||  ||     c
      cgag gaga gA GU CGGAAC CACA CCU  ca     u
----uc    c    a  C  U      C    C   CC  uuaau 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 50003148-50003238 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-532
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-532 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-532-5p

Accession MIMAT0002888
Description Homo sapiens hsa-miR-532-5p mature miRNA
Sequence 20 - CAUGCCUUGAGUGUAGGACCGU - 41
Evidence experimental
PCR [1], cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-532-3p

Accession MIMAT0004780
Description Homo sapiens hsa-miR-532-3p mature miRNA
Sequence 57 - CCUCCCACACCCAAGGCUUGCA - 78
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PCR-based expression analysis and identification of microRNAs
    "Lu DP, Read RL, Humphreys DT, Battah FM, Martin DIK, Rasko JEJ"
    "RNAi and Gene Silencing (2005) 1:44-49