MIR532 is a microRNA that has been implicated in various cellular processes and diseases, including cancer. It was significantly up-regulated in a majority of HCC-post HCV positive patients, indicating a potential role in liver cancer pathogenesis [PMC3245605]. Interestingly, MIR532 has been shown to inhibit the invasiveness of parental tumor cells and is not regulated by TERT, suggesting its role as a tumor suppressor [PMC8253104]. It is located upstream of miR500A and acts as a negative regulator of TERT in ovarian cancer by decreasing cell proliferation and invasion capacity [PMC8253104]. MIR532's expression was not affected by TERT binding to the upstream region containing TBE sequences, which contrasts with miR500A that is regulated by TERT [PMC8253104]. In the context of ovarian cancer, MIR532 expression levels were correlated with overall survival outcomes for patients [PMC7359466]. Additionally, high levels of exosomal MIR532 were associated with favorable overall survival in acute myeloid leukemia (AML) patients, suggesting its potential as a prognostic biomarker [PMC7912829]. The promoter activity of MIR532 can be activated by the introduction of transcription factors such as TTF-1 but is not affected by DNA hypermethylation; this indicates other regulatory mechanisms at play for this microRNA's expression [PMC5497805].
cgacuu u c c U A A CC uggca
gcuu cucu cu CA GCCUUG GUGU GGA GU u
|||| |||| || || |||||| |||| ||| || c
cgag gaga gA GU CGGAAC CACA CCU ca u
----uc c a C U C C CC uuaau
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002888 |
| Description | Homo sapiens hsa-miR-532-5p mature miRNA |
| Sequence | 20 - CAUGCCUUGAGUGUAGGACCGU - 41 |
| Evidence |
experimental
PCR [1], cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004780 |
| Description | Homo sapiens hsa-miR-532-3p mature miRNA |
| Sequence | 57 - CCUCCCACACCCAAGGCUUGCA - 78 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|