Stem-loop ppt-MIR156a

Accession

MI0003506

Description

Physcomitrella patens ppt-MIR156a precursor miRNA

Literature search

5 open access papers mention ppt-MIR156a
(10 sentences)

Sequence

ggcgguggaggaugugggagUGACAGAAGAGAGUGAGCACagcugagcauguacaugaggaaguacuugcccaugugugcucacucucuuccugucgcaccucuccuuugacgcu
((((..((((((.(.((..((((((((((((((((((((((..((.(((.((((........)))).))).))..))))))))))))))).))))))).)).)))))))..))))

Structure

    gu      u u  ga       -               gc  a   u    aug 
ggcg  ggagga g gg  gUGACAG AAGAGAGUGAGCACa  ug gca guac   a
||||  |||||| | ||  ||||||| |||||||||||||||  || ||| ||||    
ucgc  uuuccu c cc  cgcuguc uucucucacucgugu  ac cgu caug   g
    ag      - u  -a       c               gu  c   u    aag 

Annotation confidence Not enough data

Genome context

Chr22: 4117123-4117237 [+]

Mature ppt-miR156a

• Accession: MIMAT0003143
• Description: Physcomitrella patens ppt-miR156a mature miRNA
• Sequence: 21 - UGACAGAAGAGAGUGAGCAC - 40
• Evidence: experimental ; cloned [1-2], 454 [3]

References

1. PubMed ID: 16146523
   Cloning and characterization of micro-RNAs from moss
   "Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC"
   "Plant J (2005) 43:837-848


2. PubMed ID: 17359535
   Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution
   Fattash I, Voss B, Reski R, Hess WR, Frank W
   BMC Plant Biol (2007) 7:13


3. PubMed ID: 17601824
   Common functions for diverse small RNAs of land plants
   "Axtell MJ, Snyder JA, Bartel DP"
   "Plant Cell (2007) 19:1750-1769