miRBase entry: hsa-mir-455

Stem-loop hsa-mir-455


Accession
MI0003513
Symbol
HGNC: MIR455
Description
Homo sapiens hsa-mir-455 precursor miRNA mir-455
Gene
family?
RF00709; mir-455

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR455 is a microRNA with a role in various physiological and pathological processes. It is specifically implicated in hepatocellular carcinoma (HCC), being tumor type specific and also associated with gastric cancer (GC) and colorectal cancer (CRC) [PMC8369952]. Additionally, MIR455 is involved in the differentiation of brown adipocytes, a process essential for thermogenesis [PMC7123371]. In the context of multiple myeloma (MM), high expression levels of MIR455 may serve as a favorable prognostic indicator, and its expression profile has been linked to bortezomib resistance [PMC6183594]. Aberrant MIR455 expression has been suggested to contribute to the pathogenesis of preeclampsia (PE) early in pregnancy [PMC4540200]. Exercise-induced changes in exosomal content, including MIR455, have been observed in type 2 diabetic mice, indicating its role in intercellular communication [PMC4568920]. In the alimentary system, MIR455 is associated with response to stimuli [PMC8369952], and it exhibits cardioprotective properties in diabetes mellitus type 1 [PMC7593653]. The formation of MIR455 is induced by cold exposure and bone morphogenetic protein 7 (BMP7) within brown adipose tissue (BAT), highlighting its importance for BAT development [PMC7123371]. Functional studies using a dual luciferase-based assay have confirmed that both strands of MIR455 are involved in microRNA-induced silencing complex (miRISC) activity, indicating their regulatory potential on target genes such as COL27A1 gene expression within BeWo cells upon forskolin treatment [PMC4540200].

Literature search
75 open access papers mention hsa-mir-455
(620 sentences)

Sequence

49975 reads, 927 reads per million, 127 experiments
ucccuggcgugagggUAUGUGCCUUUGGACUACAUCGuggaagccagcaccauGCAGUCCAUGGGCAUAUACACuugccucaaggccuaugucauc
.....(((.(((((((((((((((.((((((.(((.(((........))).))).)))))).)))))))))).....)))))..))).........

Structure
----ucccu   -g     -----          U      A   C   gaa 
         ggc  ugagg     gUAUGUGCCU UGGACU CAU Gug   g
         |||  |||||     |||||||||| |||||| ||| |||    
         ccg  acucc     CAUAUACGGG ACCUGA Gua cac   c
cuacuguau   ga     guuCA          U      C   c   gac 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The mir-455 precursor was predicted computationally and a 5' mature product verified in human by Northern blot [1]. The precise sequence termini of the mature forms were derived by cloning from human and rat samples [2].

Genome context
chr9: 114209434-114209529 [+]

Disease association
hsa-mir-455 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-455-5p

Accession MIMAT0003150
Description Homo sapiens hsa-miR-455-5p mature miRNA
Sequence 16 - UAUGUGCCUUUGGACUACAUCG - 37
Evidence experimental
Northern [1], cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-455-3p

Accession MIMAT0004784
Description Homo sapiens hsa-miR-455-3p mature miRNA
Sequence 54 - GCAGUCCAUGGGCAUAUACAC - 74
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15652478
    Phylogenetic shadowing and computational identification of human microRNA genes
    "Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E"
    "Cell (2005) 120:21-24