WARNING: This summary was generated by AI. MIR455 is a microRNA with a role in various physiological and pathological processes. It is specifically implicated in hepatocellular carcinoma (HCC), being tumor type specific and also associated with gastric cancer (GC) and colorectal cancer (CRC) [PMC8369952]. Additionally, MIR455 is involved in the differentiation of brown adipocytes, a process essential for thermogenesis [PMC7123371]. In the context of multiple myeloma (MM), high expression levels of MIR455 may serve as a favorable prognostic indicator, and its expression profile has been linked to bortezomib resistance [PMC6183594]. Aberrant MIR455 expression has been suggested to contribute to the pathogenesis of preeclampsia (PE) early in pregnancy [PMC4540200]. Exercise-induced changes in exosomal content, including MIR455, have been observed in type 2 diabetic mice, indicating its role in intercellular communication [PMC4568920]. In the alimentary system, MIR455 is associated with response to stimuli [PMC8369952], and it exhibits cardioprotective properties in diabetes mellitus type 1 [PMC7593653]. The formation of MIR455 is induced by cold exposure and bone morphogenetic protein 7 (BMP7) within brown adipose tissue (BAT), highlighting its importance for BAT development [PMC7123371]. Functional studies using a dual luciferase-based assay have confirmed that both strands of MIR455 are involved in microRNA-induced silencing complex (miRISC) activity, indicating their regulatory potential on target genes such as COL27A1 gene expression within BeWo cells upon forskolin treatment [PMC4540200].
----ucccu -g ----- U A C gaa
ggc ugagg gUAUGUGCCU UGGACU CAU Gug g
||| ||||| |||||||||| |||||| ||| |||
ccg acucc CAUAUACGGG ACCUGA Gua cac c
cuacuguau ga guUCA U C c gac
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003150 |
| Description | Homo sapiens hsa-miR-455-5p mature miRNA |
| Sequence | 16 - UAUGUGCCUUUGGACUACAUCG - 37 |
| Evidence |
experimental
Northern [1], cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004784 |
| Description | Homo sapiens hsa-miR-455-3p mature miRNA |
| Sequence | 54 - GCAGUCCAUGGGCAUAUACACU - 75 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
|