miRBase entry: hsa-mir-545

Stem-loop hsa-mir-545


Accession
MI0003516
Symbol
HGNC: MIR545
Description
Homo sapiens hsa-mir-545 precursor miRNA mir-95
Gene
family?
RF04053; mir-95

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR545, identified as a pre-miRNA, has been observed to play a role in cell proliferation in colorectal cancer and is significantly upregulated in endometrial cancer [PMC7199595]. Despite its upregulation, no miRNA prediction binding site tool has confirmed a direct connection between MIR545 and GPR161, suggesting that while MIR545 may promote cell proliferation in UCEC, its effects likely involve additional factors [PMC7199595]. In cervical cancer (CC), MIR545 is targeted by circ_0067934, which acts as a sponge to downregulate its expression and is implicated in the progression of CC by inhibiting MIR545 and increasing EIF3C expression [PMC9260044]. Moreover, the overexpression of MIR545 has been linked to the inhibition of Ku70 activity in radioresistant Lewis Lung Carcinoma cell lines [PMC4453103] and is regulated by HBx [PMC9280728]. However, the statement that MIR545 directly targets RIG-I regulators in pancreatic ductal adenocarcinoma is not supported by the provided reference [PMC6370596]. Experiments using miRNA mimics have shown that a mimic for MIR545 produced no phenotype compared to control cells [PMC7801944], while estrogen-related receptor γ (ESRRG) has been identified as a potential target gene inversely related to the expression of MIR545 [PMC8789654].

Literature search
51 open access papers mention hsa-mir-545
(126 sentences)

Sequence

5530 reads, 28.0 reads per million, 127 experiments
cccagccuggcacauuaguaggccUCAGUAAAUGUUUAUUAGAUGAauaaaugaaugacucaUCAGCAAACAUUUAUUGUGUGCcugcuaaagugagcuccacagg
.....((((((((.((((((((((.((((((((((((.((.(((((.............))))))).)))))))))))).).))))))))).))).....).))))

Structure
cccag    - -----   a         - U            A  A     auaaa 
     ccug g     cac uuaguaggc c CAGUAAAUGUUU UU GAUGA     u
     |||| |     ||| ||||||||| | |||||||||||| || |||||     g
     ggac c     gug aaucgucCG G GUUAUUUACAAA GA CUacu     a
-----    a cucga   a         U U            C  -     cagua 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chrX: 74287104-74287209 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-545
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-545 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-545-5p

Accession MIMAT0004785
Description Homo sapiens hsa-miR-545-5p mature miRNA
Sequence 25 - UCAGUAAAUGUUUAUUAGAUGA - 46
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-545-3p

Accession MIMAT0003165
Description Homo sapiens hsa-miR-545-3p mature miRNA
Sequence 63 - UCAGCAAACAUUUAUUGUGUGC - 84
Evidence experimental
cloned [1-2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267