miRBase entry: mmu-mir-541

Stem-loop mmu-mir-541


Accession
MI0003521
Symbol
MGI: Mir541
Description
Mus musculus mmu-mir-541 precursor miRNA mir-541
Gene
family?
RF00777; mir-541

Literature search
11 open access papers mention mmu-mir-541
(73 sentences)

Sequence

610764 reads, 1434 reads per million, 99 experiments
gccaaaaucagagAAGGGAUUCUGAUGUUGGUCACACUccaagaguuuuaaaaugagUGGCGAACACAGAAUCCAUACUcugcuuauggc
((((.((.(((((...((((((((.((((.(((((((((...))))..........))))).))))))))))))...))))).)).))))

Structure
    a  u     AAG        A    G     ----------    c 
gcca aa cagag   GGAUUCUG UGUU GUCAC          ACUc  
|||| || |||||   |||||||| |||| |||||          |||| a
cggu uu gucUC   CCUAAGAC ACAA CGGUg          ugag  
    a  c     AUA        -    G     aguaaaauuu    a 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr12: 109742409-109742498 [+]
Clustered miRNAs
13 other miRNAs are < 10 kb from mmu-mir-541
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-541-5p

Accession MIMAT0003170
Description Mus musculus mmu-miR-541-5p mature miRNA
Sequence 14 - AAGGGAUUCUGAUGUUGGUCACACU - 38
Evidence experimental
cloned [1,3], miRAP-cloned [2], Illumina [4]
Database links
Predicted targets

Mature mmu-miR-541-3p

Accession MIMAT0017209
Description Mus musculus mmu-miR-541-3p mature miRNA
Sequence 58 - UGGCGAACACAGAAUCCAUACU - 79
Evidence experimental
Illumina [5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  5. PubMed ID: 16973894
    Mouse microRNA profiles determined with a new and sensitive cloning method
    "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
    "Nucleic Acids Res (2006) 34:e115