WARNING: This summary was generated by AI. MIR487B is a microRNA that is part of the miR655 miRNA cluster, which includes a total of 20 miRNAs, with expression data available for nine of these, including MIR487B [PMC7465874]. This microRNA has been identified with 16 mutations, including a hotspot mutation in the seed sequence that is particularly associated with melanoma [PMC9708458]. MIR487B expression has been found to be downregulated in gliomas, although its specific role in these tumors remains to be fully elucidated [PMC5288128]. Functionally, MIR487B has been shown to inhibit the IL-33/ST2 signaling axis and improve cardiac morphology in a model of chronic heart failure [PMC8663982]. Additionally, it is part of the DLK1-MEG3 cluster on chromosome 14q32 and has been found to be downregulated due to DNA hypermethylation in bladder tumors [PMC4348104]. Its expression also appears to be reduced in multiple sclerosis (MS) and can be epigenetically downregulated by tobacco smoking, leading to overexpression of genes involved in stem cell modulation [PMC4655260; PMC6116004].. Furthermore, MIR487B expression levels have been associated with patient survival outcomes and are implicated in angiogenesis through A-to-I editing and Nm modifications that can alter its target specificity [PMC5975595; PMC9916637].. Elevated levels have also been observed in peripheral blood mononuclear cells from stroke patients [PMC7123062].
u u UUAU C U uuuug ugguacu ggagaGUGG CCCUGU C GUUCG c ||||||| ||||||||| |||||| | ||||| acuauga uuuUUCACC GGGACA G UAAgc u a c UACU U C uguac
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003180 |
| Description | Homo sapiens hsa-miR-487b-3p mature miRNA |
| Sequence | 51 - AAUCGUACAGGGUCAUCCACUU - 72 |
| Evidence |
experimental
cloned [1-2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026614 |
| Description | Homo sapiens hsa-miR-487b-5p mature miRNA |
| Sequence | 15 - GUGGUUAUCCCUGUCCUGUUCG - 36 |
| Evidence |
experimental
Illumina [3] |
|