miRBase entry: hsa-mir-92b

Stem-loop hsa-mir-92b


Accession
MI0003560
Symbol
HGNC: MIR92B
Description
Homo sapiens hsa-mir-92b precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR92B, a microRNA expressed in the developing mouse brain, has been implicated in various biological processes including the attenuation of inflammatory responses and autophagy by targeting TRAF3 and the MKK3-p38 pathway in acute pancreatitis [PMC9960688]. It is predicted to reside within the Cia10 interval on rat chromosome 2 and has been shown to negatively modulate EZH2 expression, influencing autophagy in different tumor models [PMC3339715], [PMC8000899]. MIR92B is also involved in neuronal development and differentiation, with its dysregulation potentially linked to developmental processes [PMC5764268]. It has been suggested that MIR92B may target C/EBPß, a gene important for cell cycle regulation, although further research is needed to confirm this interaction in humans [PMC3732262]. In zebrafish embryos, MIR92B plays a crucial role in organogenesis and body patterning by affecting endodermal cell formation during early developmental stages [PMC9837005]. Its expression patterns vary across different tissues and developmental stages; for instance, it is differentially expressed in various organs of adult zebrafish but localized specifically within certain brain regions during embryogenesis [PMC9837005]. In human malignancies such as breast cancer, MIR92B expression inversely correlates with EZH2 levels and affects autophagy markers during basal or induced autophagy conditions [PMC6952790].

Literature search
201 open access papers mention hsa-mir-92b
(623 sentences)

Sequence

93971 reads, 954 reads per million, 127 experiments
cgggccccgggcgggcgggAGGGACGGGACGCGGUGCAGUGuuguuuuuucccccgccaaUAUUGCACUCGUCCCGGCCUCCggcccccccggccc
.(((((..(((.((((.(((((..(((((((.((((((((((((.............))))))))))))))))))).))))).))))))).)))))

Structure
c     cc   c    g     GA       C            uuuuu 
 gggcc  ggg gggc ggAGG  CGGGACG GGUGCAGUGuug     u
 |||||  ||| |||| |||||  ||||||| ||||||||||||     c
 cccgg  ccc cccg CCUCC  GCCCUGC UCACGUUAUaac     c
-     -c   -    g     -G       -            cgccc 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr1: 155195177-155195272 [+]

Disease association
hsa-mir-92b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-92b is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-92b is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-92b-5p

Accession MIMAT0004792
Description Homo sapiens hsa-miR-92b-5p mature miRNA
Sequence 20 - AGGGACGGGACGCGGUGCAGUG - 41
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-92b-3p

Accession MIMAT0003218
Description Homo sapiens hsa-miR-92b-3p mature miRNA
Sequence 61 - UAUUGCACUCGUCCCGGCCUCC - 82
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692