Stem-loop hsa-mir-574

Accession

MI0003581

Symbol

HGNC: MIR574

Description

Homo sapiens hsa-mir-574 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR574 is a microRNA that has been identified in various studies and is associated with different biological processes and diseases. It has been reported that MIR574, along with let-7b and miR21, can act as a self-ligand of TLR7 for plasmacytoid DCs activation in systemic lupus erythematosus (SLE) patients [PMC9762196]. MIR574 is located on human chromosome 4p14 and is generated through a multi-step process [PMC9855975]. It has also been found to be age-demethylated in MIR10A and age-methylated in MIR219-2, MIR183/MIR96, and MIRLET7A3/MIRLET7B [PMC4396570]. In studies on CNS tumors, including glioblastoma, MIR574 was found to be down-regulated along with other miRNAs (MIR149, MIR214, MIR595, and MIR765) [PMC8235499]. Additionally, it was observed that the down-regulation of these miRNAs could serve as diagnostic markers for CNS tumors [PMC8235499]. In other studies on different cancers such as gastric cancer, thyroid cancer, brain cancer, head and neck squamous cell carcinoma (HNSCC), and esophageal squamous cell carcinoma (ESCC), the dysregulation of MIR574 was also observed [PMC9775590] [PMC9098838]. These findings highlight the potential role of MIR574 in various diseases and its potential as a diagnostic or prognostic marker.

Literature search

96 open access papers mention hsa-mir-574
(449 sentences)

Sequence

54112 reads, 1138 reads per million, 145 experiments

gggaccugcgugggugcgggcgugUGAGUGUGUGUGUGUGAGUGUGUgucgcuccgggucCACGCUCAUGCACACACCCACAcgcccacacucagg
........(.((((((.(((((((((.(.(((((((((((((((((.(.(.(....)).)))))))))))))))))))))))))))).)))))).)

Structure

gggaccug g      c         A U                 U u g u 
        c ugggug gggcgugUG G GUGUGUGUGUGAGUGUG g c c c
        | |||||| ||||||||| | ||||||||||||||||| | | |  
        g acucac cccgcACAC C CACACACGUACUCGCAC c g g c
-------- g      a         - -                 - u - g 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chr4: 38868032-38868127 [+]

Disease association

hsa-mir-574 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-574-5p

• Accession: MIMAT0004795
• Description: Homo sapiens hsa-miR-574-5p mature miRNA
• Sequence: 25 - UGAGUGUGUGUGUGUGAGUGUGU - 47
• Evidence: experimental ; cloned [2]

Mature hsa-miR-574-3p

• Accession: MIMAT0003239
• Description: Homo sapiens hsa-miR-574-3p mature miRNA
• Sequence: 61 - CACGCUCAUGCACACACCCACA - 82
• Evidence: experimental ; Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692