miRBase entry: hsa-mir-582

Stem-loop hsa-mir-582


Accession
MI0003589
Symbol
HGNC: MIR582
Description
Homo sapiens hsa-mir-582 precursor miRNA mir-582
Gene
family?
RF00927; mir-582

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR582 is a microRNA (miRNA) that is notably upregulated in the CNFPA adenoma cluster, along with miR4774 and LINC01351, and is implicated in the regulation of various cellular pathways [PMC7652879]. This miRNA has been identified as a key player in enhancing epithelial-mesenchymal transition (EMT) by positively regulating the Wnt–β-catenin pathway, which is crucial for cancer progression [PMC7602903]. MIR582's role extends to maintaining cancer stem cell (CSC) stemness through activation of the WNT pathway, highlighting its potential as a therapeutic target for disrupting CSC regulatory networks [PMC9517164]. In non-small-cell lung cancer (NSCLC), MIR582 upregulation has been linked to increased expression of CSC-related genes and is associated with DNA copy number variations that suggest its overexpression may be tied to genetic alterations in lung cancer [PMC9517164; PMC4667703].'>PMC4667703].. The gene locus for MIR582 has been found to be frequently amplified across various lung cancer cell lines, further supporting its role in oncogenesis [PMC4667703].

Literature search
36 open access papers mention hsa-mir-582
(207 sentences)

Sequence

7371 reads, 126 reads per million, 124 experiments
aucugugcucuuugaUUACAGUUGUUCAACCAGUUACUaaucuaacuaauugUAACUGGUUGAACAACUGAACCcaaagggugcaaaguagaaacauu
...(((((((((((....(((((((((((((((((((..............)))))))))))))))))))....))))))))))).............

Structure
----------auc           aUUA                   Uaaucu 
             ugugcucuuug    CAGUUGUUCAACCAGUUAC      a
             |||||||||||    |||||||||||||||||||       
             acgugggaaac    GUCAACAAGUUGGUCAAUg      a
uuacaaagaugaa           CCAA                   uuaauc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr5: 59703606-59703703 [-]

Disease association
hsa-mir-582 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-582-5p

Accession MIMAT0003247
Description Homo sapiens hsa-miR-582-5p mature miRNA
Sequence 16 - UUACAGUUGUUCAACCAGUUACU - 38
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-582-3p

Accession MIMAT0004797
Description Homo sapiens hsa-miR-582-3p mature miRNA
Sequence 53 - UAACUGGUUGAACAACUGAACC - 74
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692