WARNING: This summary was generated by AI. MIR582 is a microRNA (miRNA) that is notably upregulated in the CNFPA adenoma cluster, along with miR4774 and LINC01351, and is implicated in the regulation of various cellular pathways [PMC7652879]. This miRNA has been identified as a key player in enhancing epithelial-mesenchymal transition (EMT) by positively regulating the Wnt–β-catenin pathway, which is crucial for cancer progression [PMC7602903]. MIR582's role extends to maintaining cancer stem cell (CSC) stemness through activation of the WNT pathway, highlighting its potential as a therapeutic target for disrupting CSC regulatory networks [PMC9517164]. In non-small-cell lung cancer (NSCLC), MIR582 upregulation has been linked to increased expression of CSC-related genes and is associated with DNA copy number variations that suggest its overexpression may be tied to genetic alterations in lung cancer [PMC9517164; PMC4667703].'>PMC4667703].. The gene locus for MIR582 has been found to be frequently amplified across various lung cancer cell lines, further supporting its role in oncogenesis [PMC4667703].
----------auc aUUA Uaaucu
ugugcucuuug CAGUUGUUCAACCAGUUAC a
||||||||||| |||||||||||||||||||
acgugggaaac GUCAACAAGUUGGUCAAUg a
uuacaaagaugaa CCAA uuaauc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003247 |
| Description | Homo sapiens hsa-miR-582-5p mature miRNA |
| Sequence | 16 - UUACAGUUGUUCAACCAGUUACU - 38 |
| Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004797 |
| Description | Homo sapiens hsa-miR-582-3p mature miRNA |
| Sequence | 53 - UAACUGGUUGAACAACUGAACC - 74 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
|