miRBase entry: hsa-mir-582

Stem-loop hsa-mir-582


Accession
MI0003589
Symbol
HGNC: MIR582
Description
Homo sapiens hsa-mir-582 precursor miRNA mir-582
Gene
family?
RF00927; mir-582

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR582 is a microRNA that is upregulated in various types of adenoma clusters, including the ACTH adenoma group, the CNFPA cluster, and the GH, TSH, and PRL adenoma cluster [PMC10032474]. It is also found in the monocot lineage [PMC4723133]. The length of MIR582 varies depending on the cell line, with a length of approximately 1.55 Mb in the GM12878 cell line and 765 kb in the UML49 cell line [PMC6824518]. MIR582 has been found to play a role in enhancing epithelial-mesenchymal transition (EMT) by activating the Wnt-β-catenin pathway [PMC7602903]. Targeting MIR582 could disrupt this regulatory network maintained by Wnt pathway genes [PMC9517164]. Upregulated expression of MIR582 has been observed in cancer stem cells (CSCs) from a non-small-cell lung cancer (NSCLC) cell line A549 and has been associated with amplification of the MIR582 gene locus in lung cancer cell lines [PMC9517164] [PMC4667703]. Additionally, MIR582 is included among several other microRNAs found in Emca3 that encode small RNAs [PMC4132170] [PMC8583574].

In summary, MIR582 is an upregulated microRNA that plays a role in various adenoma clusters and has been associated with EMT and CSCs. It also varies in length depending on the cell line and has been found to be amplified in lung cancer.

Literature search
36 open access papers mention hsa-mir-582
(207 sentences)

Sequence

8076 reads, 523 reads per million, 124 experiments
aucugugcucuuugaUUACAGUUGUUCAACCAGUUACUaaucuaacuaauugUAACUGGUUGAACAACUGAACCcaaagggugcaaaguagaaacauu
...(((((((((((....(((((((((((((((((((..............)))))))))))))))))))....))))))))))).............

Structure
----------auc           aUUA                   Uaaucu 
             ugugcucuuug    CAGUUGUUCAACCAGUUAC      a
             |||||||||||    |||||||||||||||||||       
             acgugggaaac    GUCAACAAGUUGGUCAAUg      a
uuacaaagaugaa           CCAA                   uuaauc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr5: 59703606-59703703 [-]

Disease association
hsa-mir-582 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-582-5p

Accession MIMAT0003247
Description Homo sapiens hsa-miR-582-5p mature miRNA
Sequence 16 - UUACAGUUGUUCAACCAGUUACU - 38
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-582-3p

Accession MIMAT0004797
Description Homo sapiens hsa-miR-582-3p mature miRNA
Sequence 53 - UAACUGGUUGAACAACUGAACC - 74
Evidence experimental
cloned [2-3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692