miRBase entry: hsa-mir-584

Stem-loop hsa-mir-584


Accession
MI0003591
Symbol
HGNC: MIR584
Description
Homo sapiens hsa-mir-584 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR584 is a microRNA (miRNA) that plays a role in the regulation of gene expression in various biological processes and diseases [PMC5590942]. In the context of liver expression, MIR584 was found to be upregulated, indicating a potential role in liver physiology or pathology [PMC4482373]. It is also involved in pancreatic neuroendocrine tumors (pNETs) and has been compared to other miRNAs in pancreatic ductal adenocarcinoma, suggesting its significance in pancreatic cancer biology [PMC9554633]. In the regulation of gene expression networks, MIR584 has been identified as a key component, particularly concerning the positive regulation of gene expression [PMC5590942]. In gastric carcinogenesis induced by H. pylori infection, MIR584 is among the miRNAs that are upregulated, which may contribute to inflammatory processes or cancer development [PMC5081003]. Therapeutically, exosomes designed to deliver MIR584 to glioma cells have been shown to reduce MMP-2 expression and may have implications for glioma treatment strategies [PMC10088756]. Moreover, MIR584 has been reported to regulate ovarian cancer progression by targeting lipin-1 and its low levels are associated with increased metastasis and poor prognosis [PMC8122924]. The inverse relationship between MIR584 and lipin-1 expressions suggests that MIR584 acts as a tumor suppressor by regulating lipin-1 levels in ovarian cancer cells [PMC8122924].

Literature search
25 open access papers mention hsa-mir-584
(431 sentences)

Sequence

25963 reads, 205 reads per million, 54 experiments
uagggugaccagccaUUAUGGUUUGCCUGGGACUGAGgaauuugcugggauaugUCAGUUCCAGGCCAACCAGGCUgguuggucucccugaagcaac
(((((.(((((((((...(((((.((((((((((((.(.((((....)))).).)))))))))))).)))))...))))))))).))))).......

Structure
-------     u         UUA     U            G a    g 
       uaggg gaccagcca   UGGUU GCCUGGGACUGA g auuu c
       ||||| |||||||||   ||||| |||||||||||| | ||||  
       guccc cugguuggU   ACCAA CGGACCUUGACU u uagg u
caacgaa     u         CGG     C            g a    g 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr5: 149062313-149062409 [-]

Disease association
hsa-mir-584 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-584-5p

Accession MIMAT0003249
Description Homo sapiens hsa-miR-584-5p mature miRNA
Sequence 16 - UUAUGGUUUGCCUGGGACUGAG - 37
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-584-3p

Accession MIMAT0022708
Description Homo sapiens hsa-miR-584-3p mature miRNA
Sequence 55 - UCAGUUCCAGGCCAACCAGGCU - 76
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692