WARNING: This summary was generated by AI. MIR584 is a microRNA (miRNA) that plays a role in the regulation of gene expression in various biological processes and diseases [PMC5590942]. In the context of liver expression, MIR584 was found to be upregulated, indicating a potential role in liver physiology or pathology [PMC4482373]. It is also involved in pancreatic neuroendocrine tumors (pNETs) and has been compared to other miRNAs in pancreatic ductal adenocarcinoma, suggesting its significance in pancreatic cancer biology [PMC9554633]. In the regulation of gene expression networks, MIR584 has been identified as a key component, particularly concerning the positive regulation of gene expression [PMC5590942]. In gastric carcinogenesis induced by H. pylori infection, MIR584 is among the miRNAs that are upregulated, which may contribute to inflammatory processes or cancer development [PMC5081003]. Therapeutically, exosomes designed to deliver MIR584 to glioma cells have been shown to reduce MMP-2 expression and may have implications for glioma treatment strategies [PMC10088756]. Moreover, MIR584 has been reported to regulate ovarian cancer progression by targeting lipin-1 and its low levels are associated with increased metastasis and poor prognosis [PMC8122924]. The inverse relationship between MIR584 and lipin-1 expressions suggests that MIR584 acts as a tumor suppressor by regulating lipin-1 levels in ovarian cancer cells [PMC8122924].
------- u UUA U G a g
uaggg gaccagcca UGGUU GCCUGGGACUGA g auuu c
||||| ||||||||| ||||| |||||||||||| | ||||
guccc cugguuggU ACCAA CGGACCUUGACU u uagg u
caacgaa u CGG C g a g
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003249 |
| Description | Homo sapiens hsa-miR-584-5p mature miRNA |
| Sequence | 16 - UUAUGGUUUGCCUGGGACUGAG - 37 |
| Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022708 |
| Description | Homo sapiens hsa-miR-584-3p mature miRNA |
| Sequence | 55 - UCAGUUCCAGGCCAACCAGGCU - 76 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|