MIR642A is a microRNA that has been found to be downregulated in multiple myeloma (MM) patients [PMC5395780]. It has been shown to modulate the expression of DEPTOR, a protein involved in the regulation of cell size and endoplasmic reticulum (ER) mass [PMC5395780]. The downregulation of DEPTOR by transfection of MM cells with miR135b or MIR642A resulted in the downregulation of IRF4 and k light chain proteins, indicating a role for MIR642A in modulating the transcriptional program of myeloma cells [PMC5395780]. Luciferase reporter assays and gain-of-function experiments confirmed that transfection of miR135b and MIR642A decreased DEPTOR levels in myeloma cells [PMC5395780'>PMC5395780'>PMC5395780]. Furthermore, knockdown of MIR642A and miR135b resulted in increased DEPTOR expression, providing further evidence for their role in controlling DEPTOR levels [PMC5395780]. The 3'UTR of DEPTOR contains binding sites for both MIR642A and miR135b, as confirmed by luciferase reporter assays [PMC5395780]. These findings suggest that the downregulation of MIR642A and miR135b may contribute to the overexpression of DEPTOR observed in MM patients [PMC5395780].
------------aucu G ggu gaguugggagg UCCCUCUCCAAAUGUGUCUUGg g ||||||||||| |||||||||||||||||||||| g cucaacccuCC AGGGAGAGGUUUACACAGAacu g uuacuaccgucuccgg A agg
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003312 |
Description | Homo sapiens hsa-miR-642a-5p mature miRNA |
Sequence | 16 - GUCCCUCUCCAAAUGUGUCUUG - 37 |
Evidence |
experimental
RT-PCR [1], SAGE [1], cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0020924 |
Description | Homo sapiens hsa-miR-642a-3p mature miRNA |
Sequence | 51 - AGACACAUUUGGAGAGGGAACC - 72 |
Evidence |
experimental
SOLiD [3] |
Database links | |
Predicted targets |
|