Stem-loop hsa-mir-548d-1

Accession

MI0003668

Symbol

HGNC: MIR548D1

Description

Homo sapiens hsa-mir-548d-1 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR548D1 is a non-coding RNA gene that produces two mature microRNAs, miR-548d-5p and miR-548d-3p, which target JunD [PMC6959298]. The MIR548D1 promoter luciferase reporter plasmid was constructed by cloning a 1000 bp fragment before the transcription starting site into the pEZX-FR01 plasmid [PMC6959298]. The study aimed to investigate the involvement of FOXD3 and BRD4 in the transcription of MIR548D1, and a luciferase reporter containing its promoter region was generated [PMC6959298]. The study found that FOXD3 is a putative transcription factor for MIR548D1 gene, as predicted by several transcription regulation databases [PMC6959298'>PMC6959298'>PMC6959298'>PMC6959298]. Additionally, bioinformatics analysis of The Cancer Genome Atlas (TCGA) revealed that MIR548D1 is uniquely upregulated in the basal-like subtype of breast cancer compared to other subtypes [PMC6959298]. Furthermore, both mature products of MIR548D1 have putative binding sites on the 3′UTR region of JUND [PMC6959298]. The study also showed that BRD4/FOXD3 was enriched in the promoter region of MIR548D1 through luciferase and sequential ChIP assays [PMC6959298]. Interestingly, FOXD3 expression is also highly expressed in basal-like breast cancer based on TCGA analysis, similar to MIR548D1 expression [PMC6959298]. Finally, among the top 20 upregulated differentially expressed genes (DEGs), eight genes were identified as newly androgen receptor (AR)-regulated genes including CYP4F8 and MIR548D1 [PMC9107748].

Literature search

59 open access papers mention hsa-mir-548d-1
(280 sentences)

Sequence

4189 reads, 205 reads per million, 90 experiments

aaacaaguuauauuagguuggugcAAAAGUAAUUGUGGUUUUUGCCuguaaaaguaauggCAAAAACCACAGUUUCUUUUGCaccagacuaauaaag
..........((((((..(((((((((((.((((((((((((((((............)))))))))))))))).)))))))))))..))))))...

Structure

aaacaaguua      gu           U                uguaa 
          uauuag  uggugcAAAAG AAUUGUGGUUUUUGCC     a
          ||||||  ||||||||||| ||||||||||||||||      
          auaauc  accaCGUUUUC UUGACACCAAAAACgg     a
-------gaa      ag           U                uaaug 

Annotation confidence High

Genome context

chr8: 123348034-123348130 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-548d-1

Disease association

hsa-mir-548d-1 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-548d-5p

• Accession: MIMAT0004812
• Description: Homo sapiens hsa-miR-548d-5p mature miRNA
• Sequence: 25 - AAAAGUAAUUGUGGUUUUUGCC - 46
• Evidence: experimental ; cloned [2]

Mature hsa-miR-548d-3p

• Accession: MIMAT0003323
• Description: Homo sapiens hsa-miR-548d-3p mature miRNA
• Sequence: 61 - CAAAAACCACAGUUUCUUUUGC - 82
• Evidence: experimental ; RT-PCR [1], SAGE [1], cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692