Stem-loop hsa-mir-548d-1

Accession

MI0003668

Symbol

HGNC: MIR548D1

Description

Homo sapiens hsa-mir-548d-1 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR548D1 is a non-coding RNA gene associated with the production of two mature microRNAs, miR-548d-5p and miR-548d-3p, which are implicated in targeting the JunD protein [PMC6959298]. A luciferase reporter assay was utilized to investigate the transcriptional regulation of MIR548D1, revealing that transcription factors FOXD3 and BRD4 are involved in its expression [PMC6959298]. The FOXD3 binding motif within the MIR548D1 promoter is critical for its transcriptional activity, as shown by deletion studies [PMC6959298]. Moreover, super-enhancer elements are suggested to facilitate the processing of primary miRNAs including MIR548D1 by recruiting Drosha/DGCR8 [PMC6959298'>PMC6959298]. BRD4's presence at the MIR548D1 promoter was found to be reduced in JQ1-resistant cell clones compared to parental cells, indicating a role for BRD4 in gene regulation that can be disrupted by therapeutic agents [PMC6959298]. Bioinformatics analyses have shown that MIR548D1 expression is significantly upregulated in basal-like breast cancer (BLBC), and both FOXD3 and MIR548D1 exhibit high expression levels in this cancer subtype according to The Cancer Genome Atlas data [PMC6959298]. Additionally, MIR548D1 has been identified as one of several newly AR-regulated genes within upregulated differentially expressed genes (DEGs) in a related study [PMC9107748].

Literature search

59 open access papers mention hsa-mir-548d-1
(280 sentences)

Sequence

4189 reads, 205 reads per million, 90 experiments

aaacaaguuauauuagguuggugcAAAAGUAAUUGUGGUUUUUGCCuguaaaaguaauggCAAAAACCACAGUUUCUUUUGCaccagacuaauaaag
..........((((((..(((((((((((.((((((((((((((((............)))))))))))))))).)))))))))))..))))))...

Structure

aaacaaguua      gu           U                uguaa 
          uauuag  uggugcAAAAG AAUUGUGGUUUUUGCC     a
          ||||||  ||||||||||| ||||||||||||||||      
          auaauc  accaCGUUUUC UUGACACCAAAAACgg     a
-------gaa      ag           U                uaaug 

Annotation confidence High

Genome context

chr8: 123348034-123348130 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-548d-1

Disease association

hsa-mir-548d-1 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-548d-5p

• Accession: MIMAT0004812
• Description: Homo sapiens hsa-miR-548d-5p mature miRNA
• Sequence: 25 - AAAAGUAAUUGUGGUUUUUGCC - 46
• Evidence: experimental ; cloned [2]

Mature hsa-miR-548d-3p

• Accession: MIMAT0003323
• Description: Homo sapiens hsa-miR-548d-3p mature miRNA
• Sequence: 61 - CAAAAACCACAGUUUCUUUUGC - 82
• Evidence: experimental ; RT-PCR [1], SAGE [1], cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692