miRBase entry: hsa-mir-548d-1

Stem-loop hsa-mir-548d-1


Accession
MI0003668
Symbol
HGNC: MIR548D1
Description
Homo sapiens hsa-mir-548d-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR548D1 is a non-coding RNA gene associated with the production of two mature microRNAs, miR-548d-5p and miR-548d-3p, which are implicated in targeting the JunD protein [PMC6959298]. A luciferase reporter assay was utilized to investigate the transcriptional regulation of MIR548D1, revealing that transcription factors FOXD3 and BRD4 are involved in its expression [PMC6959298]. The FOXD3 binding motif within the MIR548D1 promoter is critical for its transcriptional activity, as shown by deletion studies [PMC6959298]. Moreover, super-enhancer elements are suggested to facilitate the processing of primary miRNAs including MIR548D1 by recruiting Drosha/DGCR8 [PMC6959298'>PMC6959298]. BRD4's presence at the MIR548D1 promoter was found to be reduced in JQ1-resistant cell clones compared to parental cells, indicating a role for BRD4 in gene regulation that can be disrupted by therapeutic agents [PMC6959298]. Bioinformatics analyses have shown that MIR548D1 expression is significantly upregulated in basal-like breast cancer (BLBC), and both FOXD3 and MIR548D1 exhibit high expression levels in this cancer subtype according to The Cancer Genome Atlas data [PMC6959298]. Additionally, MIR548D1 has been identified as one of several newly AR-regulated genes within upregulated differentially expressed genes (DEGs) in a related study [PMC9107748].

Literature search
59 open access papers mention hsa-mir-548d-1
(280 sentences)

Sequence

1862 reads, 205 reads per million, 83 experiments
aaacaaguuauauuagguuggugcAAAAGUAAUUGUGGUUUUUGCCuguaaaaguaauggCAAAAACCACAGUUUCUUUUGCaccagacuaauaaag
..........((((((..(((((((((((.((((((((((((((((............)))))))))))))))).)))))))))))..))))))...

Structure
aaacaaguua      gu           U                uguaa 
          uauuag  uggugcAAAAG AAUUGUGGUUUUUGCC     a
          ||||||  ||||||||||| ||||||||||||||||      
          auaauc  accaCGUUUUC UUGACACCAAAAACgg     a
-------gaa      ag           U                uaaug 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr8: 123348034-123348130 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-548d-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-548d-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-548d-5p

Accession MIMAT0004812
Description Homo sapiens hsa-miR-548d-5p mature miRNA
Sequence 25 - AAAAGUAAUUGUGGUUUUUGCC - 46
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-548d-3p

Accession MIMAT0003323
Description Homo sapiens hsa-miR-548d-3p mature miRNA
Sequence 61 - CAAAAACCACAGUUUCUUUUGC - 82
Evidence experimental
RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692