| Accession | MIMAT0004812 |
| Description | hsa-miR-548d-5p mature miRNA |
| Hairpins | |
| Sequence | AAAAGUAAUUGUGGUUUUUGCC |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.