miRBase entry: hsa-mir-1296

Stem-loop hsa-mir-1296


Accession
MI0003780
Symbol
HGNC: MIR1296
Description
Homo sapiens hsa-mir-1296 precursor miRNA mir-1296
Gene
family?
RF01921; mir-1296

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1296 is a microRNA that is involved in the serotonin-mediated signaling pathway regulating myogenic differentiation [PMC8396502]. In a study using NanoString technology, it was found that MIR1296, along with other miRNAs such as miR3185, miR28, miR182, and miR614, showed significant changes in their levels with pre-shift/post-shift or change with PoMS subscales TMD or FI [PMC9105576]. In the context of Alzheimer's disease (AD), MIR1296 was found to be downregulated in the cortex of AD patients [PMC7564652]. Additionally, MIR129-2 and MIR219A1 were also downregulated in AD patients' cortex [PMC7564652]. On the other hand, MIR199A2 and MIR92A1 were upregulated in AD patients' cortex [PMC7564652]. The dysregulation of MIR129-2, MIR219A1, and other miRNAs such as MIR29B1 and MIR199A2 has been previously reported in AD patients and was confirmed by this study [PMC7564652]. However, for some miRNAs like MIR129-2, MIR1296, and MIR99A that were found to be dysregulated in AD patients' cortex by this study as well as previous studies. The specific pathways or targets associated with these dysregulations have not been identified yet [PMC7564652].

Literature search
13 open access papers mention hsa-mir-1296
(259 sentences)

Sequence

9293 reads, 123 reads per million, 124 experiments
accuaccuaacugggUUAGGGCCCUGGCUCCAUCUCCuuuaggaaaaccuucugugggGAGUGGGGCUUCGACCCUAACCcaggugggcugu
.(((((((....(((((((((....(((((((.((((((..((((....))))..)))))))))))))....))))))))))))))))....

Structure
---a       aacu         CCCU       U      ua    a 
    ccuaccu    gggUUAGGG    GGCUCCA CUCCuu  ggaa a
    |||||||    |||||||||    ||||||| ||||||  ||||  
    gggugga    cCCAAUCCC    UCGGGGU GAGggg  ucuu c
uguc       ----         AGCU       -      ug    c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr10: 63372957-63373048 [-]

Disease association
hsa-mir-1296 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1296-5p

Accession MIMAT0005794
Description Homo sapiens hsa-miR-1296-5p mature miRNA
Sequence 16 - UUAGGGCCCUGGCUCCAUCUCC - 37
Evidence experimental
Illumina [2,4], 454 [3]
Database links
Predicted targets

Mature hsa-miR-1296-3p

Accession MIMAT0026637
Description Homo sapiens hsa-miR-1296-3p mature miRNA
Sequence 59 - GAGUGGGGCUUCGACCCUAACC - 80
Evidence experimental
Illumina [4]

References

  1. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  2. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621

  3. PubMed ID: 19508715
    Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing
    Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Møller S, Krogh A, Litman T
    BMC Med Genomics (2009) 2:35

  4. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45