WARNING: This summary was generated by AI. MIR1296 is a microRNA implicated in the regulation of myogenic differentiation through the serotonin-mediated signaling pathway [PMC8396502]. It is one of the 13 miRNAs identified by NanoString results to show significant changes in expression levels in relation to pre-shift/post-shift work and psychological mood states [PMC9105576]. In the context of Alzheimer's disease (AD), MIR1296 is notably downregulated in the cortex of patients, suggesting a potential role in the disease's pathogenesis [PMC7564652]. This downregulation has been consistently observed, confirming MIR1296's altered expression in AD [PMC7564652]. Despite its observed dysregulation, no specific pathway or target has been identified for MIR1296, indicating that further research is needed to elucidate its function and mechanism of action within AD [PMC7564652].
---a aacu CCCU U ua a
ccuaccu gggUUAGGG GGCUCCA CUCCuu ggaa a
||||||| ||||||||| ||||||| |||||| ||||
gggugga cCCAAUCCC UCGGGGU GAGggg ucuu c
uguc ---- AGCU - ug c
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005794 |
| Description | Homo sapiens hsa-miR-1296-5p mature miRNA |
| Sequence | 16 - UUAGGGCCCUGGCUCCAUCUCC - 37 |
| Evidence |
experimental
Illumina [2,4], 454 [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026637 |
| Description | Homo sapiens hsa-miR-1296-3p mature miRNA |
| Sequence | 59 - GAGUGGGGCUUCGACCCUAACC - 80 |
| Evidence |
experimental
Illumina [4] |
|