miRBase entry: hsa-mir-1296

Stem-loop hsa-mir-1296


Accession
MI0003780
Symbol
HGNC: MIR1296
Description
Homo sapiens hsa-mir-1296 precursor miRNA mir-1296
Gene
family?
RF01921; mir-1296

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR1296 is a microRNA implicated in the regulation of myogenic differentiation through the serotonin-mediated signaling pathway [PMC8396502]. It is one of the 13 miRNAs identified by NanoString results to show significant changes in expression levels in relation to pre-shift/post-shift work and psychological mood states [PMC9105576]. In the context of Alzheimer's disease (AD), MIR1296 is notably downregulated in the cortex of patients, suggesting a potential role in the disease's pathogenesis [PMC7564652]. This downregulation has been consistently observed, confirming MIR1296's altered expression in AD [PMC7564652]. Despite its observed dysregulation, no specific pathway or target has been identified for MIR1296, indicating that further research is needed to elucidate its function and mechanism of action within AD [PMC7564652].

Literature search
13 open access papers mention hsa-mir-1296
(259 sentences)

Sequence

9293 reads, 34 reads per million, 124 experiments
accuaccuaacugggUUAGGGCCCUGGCUCCAUCUCCuuuaggaaaaccuucugugggGAGUGGGGCUUCGACCCUAACCcaggugggcugu
.(((((((....(((((((((....(((((((.((((((..((((....))))..)))))))))))))....))))))))))))))))....

Structure
---a       aacu         CCCU       U      ua    a 
    ccuaccu    gggUUAGGG    GGCUCCA CUCCuu  ggaa a
    |||||||    |||||||||    ||||||| ||||||  ||||  
    gggugga    cCCAAUCCC    UCGGGGU GAGggg  ucuu c
uguc       ----         AGCU       -      ug    c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr10: 63372957-63373048 [-]

Disease association
hsa-mir-1296 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1296-5p

Accession MIMAT0005794
Description Homo sapiens hsa-miR-1296-5p mature miRNA
Sequence 16 - UUAGGGCCCUGGCUCCAUCUCC - 37
Evidence experimental
Illumina [2,4], 454 [3]
Database links
Predicted targets

Mature hsa-miR-1296-3p

Accession MIMAT0026637
Description Homo sapiens hsa-miR-1296-3p mature miRNA
Sequence 59 - GAGUGGGGCUUCGACCCUAACC - 80
Evidence experimental
Illumina [4]

References

  1. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  2. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621

  3. PubMed ID: 19508715
    Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing
    Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Møller S, Krogh A, Litman T
    BMC Med Genomics (2009) 2:35

  4. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45