miRBase entry: hsa-mir-378d-2

Stem-loop hsa-mir-378d-2


Accession
MI0003840
Symbol
HGNC: MIR378D2
Description
Homo sapiens hsa-mir-378d-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR378D2 is a human microRNA located on a different chromosome than its counterpart MIR378D1 and is notably expressed in a variety of cell lines, with particularly high expression in esophageal cell lines [PMC8697470]. This microRNA, along with LINC00665, has been implicated in the regulation of genes involved in the ubiquitin-dependent protein catabolic process and the neurotrophin signaling pathway [PMC6012059]. Furthermore, MIR378D2 and LINC00665 together influence genes that are involved in ubiquitin-dependent protein catabolism and the cellular response to calcium ions [PMC6012059]. In a study examining differentially expressed genes (DEGs), MIR378D2 was found to coregulate 55 DEGs alongside LINC00665, highlighting its role in gene regulation [PMC6012059].

Literature search
196 open access papers mention hsa-mir-378d-2
(938 sentences)

Sequence

7430077 reads, 3373.0 reads per million, 197 experiments
gaaugguuacaaggagagaacACUGGACUUGGAGUCAGAAAacuuucauccaagucauucccugcucuaagucccauuucuguuccaugagauuguuu
((((((((.((.((((((((....((((((((((.(((...((((......))))......)))))))))))))...)))).)))).)).))))))))

Structure
        a  a    -    cACU          U   ---AAA    uc 
gaaugguu ca ggag agaa    GGACUUGGAG CAG      acuu  a
|||||||| || |||| ||||    |||||||||| |||      ||||   
uuuguuag gu ccuu ucuu    ccugaaucuc guc      ugaa  u
        a  a    g    -uac          -   ccuuac    cc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr8: 93916022-93916119 [-]

Database links

Mature hsa-miR-378d-5p

Accession MIMAT0018926
Description Homo sapiens hsa-miR-378d-5p mature miRNA
Sequence 22 - ACUGGACUUGGAGUCAGAAA - 41
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  2. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127