MIR378D2 is a type of microRNA that is expressed in most cell lines and ranks as the second highest in esophageal cell lines [PMC8697470]. It is part of the miR-378d family, which consists of two different chromosomes in humans, namely MIR378D1 and MIR378D2 [PMC8697470]. The target genes of LINC00665 and MIR378D2 are significantly enriched in the ubiquitin-dependent protein catabolic process, ubiquitin-protein ligase activity, and the neurotrophin signaling pathway [PMC6012059]. These target genes are mainly involved in regulating ubiquitin-dependent protein catabolism and response to calcium ion [PMC6012059]. In a study, RP4-684O24, RP11-283I3, and RP11-350G8 were found to coregulate 60 differentially expressed genes (DEGs), while LINC00665 and MIR378D2 coregulated 55 DEGs [PMC6012059]. These findings suggest that MIR378D2 plays a role in regulating protein catabolism and calcium ion response through its target genes.
a a - cACU U ---AAA uc gaaugguu ca ggag agaa GGACUUGGAG CAG acuu a |||||||| || |||| |||| |||||||||| ||| |||| uuuguuag gu ccuu ucuu ccugaaucuc guc ugaa u a a g -uac - ccuuac cc
Accession | MIMAT0018926 |
Description | Homo sapiens hsa-miR-378d mature miRNA |
Sequence | 22 - ACUGGACUUGGAGUCAGAAA - 41 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|