Stem-loop hsa-mir-378d-2

Accession

MI0003840

Symbol

HGNC: MIR378D2

Description

Homo sapiens hsa-mir-378d-2 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR378D2 is a type of microRNA that is expressed in most cell lines and ranks as the second highest in esophageal cell lines [PMC8697470]. It is part of the miR-378d family, which consists of two different chromosomes in humans, namely MIR378D1 and MIR378D2 [PMC8697470]. The target genes of LINC00665 and MIR378D2 are significantly enriched in the ubiquitin-dependent protein catabolic process, ubiquitin-protein ligase activity, and the neurotrophin signaling pathway [PMC6012059]. These target genes are mainly involved in regulating ubiquitin-dependent protein catabolism and response to calcium ion [PMC6012059]. In a study, RP4-684O24, RP11-283I3, and RP11-350G8 were found to coregulate 60 differentially expressed genes (DEGs), while LINC00665 and MIR378D2 coregulated 55 DEGs [PMC6012059]. These findings suggest that MIR378D2 plays a role in regulating protein catabolism and calcium ion response through its target genes.

Literature search

194 open access papers mention hsa-mir-378d-2
(924 sentences)

Sequence

858642 reads, 3410 reads per million, 123 experiments

gaaugguuacaaggagagaacACUGGACUUGGAGUCAGAAAacuuucauccaagucauucccugcucuaagucccauuucuguuccaugagauuguuu
((((((((.((.((((((((....((((((((((.(((...((((......))))......)))))))))))))...)))).)))).)).))))))))

Structure

        a  a    -    cACU          U   ---AAA    uc 
gaaugguu ca ggag agaa    GGACUUGGAG CAG      acuu  a
|||||||| || |||| ||||    |||||||||| |||      ||||   
uuuguuag gu ccuu ucuu    ccugaaucuc guc      ugaa  u
        a  a    g    -uac          -   ccuuac    cc 

Annotation confidence Not enough data

Genome context

chr8: 93916022-93916119 [-]

Mature hsa-miR-378d

• Accession: MIMAT0018926
• Description: Homo sapiens hsa-miR-378d mature miRNA
• Sequence: 22 - ACUGGACUUGGAGUCAGAAA - 41
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298


2. PubMed ID: 20733160
   Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
   "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
   "Blood (2010) 116:e118-e127