WARNING: This summary was generated by AI. MIR378D2 is a human microRNA located on a different chromosome than its counterpart MIR378D1 and is notably expressed in a variety of cell lines, with particularly high expression in esophageal cell lines [PMC8697470]. This microRNA, along with LINC00665, has been implicated in the regulation of genes involved in the ubiquitin-dependent protein catabolic process and the neurotrophin signaling pathway [PMC6012059]. Furthermore, MIR378D2 and LINC00665 together influence genes that are involved in ubiquitin-dependent protein catabolism and the cellular response to calcium ions [PMC6012059]. In a study examining differentially expressed genes (DEGs), MIR378D2 was found to coregulate 55 DEGs alongside LINC00665, highlighting its role in gene regulation [PMC6012059].
a a - cACU U ---AAA uc
gaaugguu ca ggag agaa GGACUUGGAG CAG acuu a
|||||||| || |||| |||| |||||||||| ||| ||||
uuuguuag gu ccuu ucuu ccugaaucuc guc ugaa u
a a g -uac - ccuuac cc
| Accession | MIMAT0018926 |
| Description | Homo sapiens hsa-miR-378d mature miRNA |
| Sequence | 22 - ACUGGACUUGGAGUCAGAAA - 41 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|