Stem-loop mmu-mir-665

Accession

MI0004171

Symbol

MGI: Mir665

Description

Mus musculus mmu-mir-665 precursor miRNA mir-665

Gene
family

RF00921; mir-665

Literature search

10 open access papers mention mmu-mir-665
(88 sentences)

Sequence

14875 reads, 340 reads per million, 72 experiments

agaacagggucuccuugAGGGGCCUCUGCCUCUAUCCAGGAUUauguuuuuaugACCAGGAGGCUGAGGUCCCUuacaggcggccucuuacucu
......(((((.((((((((((((((.((((((.....((.(((((....))))))).)))))).))))))))))).))).)))))........

Structure

--agaaca     u   -           U      AUCCA  A     u 
        ggguc ccu ugAGGGGCCUC GCCUCU     GG UUaug u
        ||||| ||| ||||||||||| ||||||     || |||||  
        uccgg gga auUCCCUGGAG CGGAGG     CC Aguau u
ucucauuc     c   c           U      ----A  -     u 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

chr12: 109586314-109586407 [+]

Clustered miRNAs

13 other miRNAs are < 10 kb from mmu-mir-665

Mature mmu-miR-665-5p

• Accession: MIMAT0017238
• Description: Mus musculus mmu-miR-665-5p mature miRNA
• Sequence: 18 - AGGGGCCUCUGCCUCUAUCCAGGAUU - 43
• Evidence: experimental ; Illumina [5]

Mature mmu-miR-665-3p

• Accession: MIMAT0003733
• Description: Mus musculus mmu-miR-665-3p mature miRNA
• Sequence: 55 - ACCAGGAGGCUGAGGUCCCU - 74
• Evidence: experimental ; MPSS [1], cloned [2-3], Illumina [4-5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 16582102
   The expression profile of microRNAs in mouse embryos
   "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
   "Nucleic Acids Res (2006) 34:1765-1771


5. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298