Stem-loop mmu-mir-499

Accession

MI0004676

Symbol

MGI: Mir499

Description

Mus musculus mmu-mir-499 precursor miRNA mir-499

Gene
family

RF00745; mir-499

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Mmu-mir-499 is a type of microRNA that has been studied in various contexts. In a study on uterine miR-499 expression, it was found that intervention with synthetic antagomiR-499 led to a decrease in miR-499 expression and an increase in the expression of the mmu-mir-499 target Lin28B [PMC5999645]. Exosomes isolated from peripheral blood plasma of mice during early pregnancy showed higher expression of mmu-mir-499 compared to non-pregnant exosomes [PMC5999645]. Inhibition of mmu-mir-499 was found to increase the risk of embryo loss and disrupt the balance of inflammation at the maternal-fetal interface, leading to an increased risk of pregnancy failure [PMC5999645]. MiRNA sequencing analysis revealed that mmu-mir-499 is regulated by Esrrb and is involved in early pregnancy [PMC9149258]. Additionally, lower levels of mmu-mir-499 have been associated with an increased risk of bovine pregnancy loss [PMC10036776]. Mmu-miR-208 and mmu-mir-499 are encoded by mouse Myh7 and Myh7b genes, respectively [PMC4410957]. Mmu-mir-1, mmu-miR-133a, mmu-miR208a, and mmu-mir-499 have been found to promote cardiac reprogramming in mouse fibroblasts into induced cardiac myocytes (iCMs) [PMC8946776]. The existence of pir5 was annotated as mmu-mir 49 9 in whole mouse embryos [PMC1874652]. Real-time PCR analysis has been used to quantify mature mir 49 9 levels in various studies [PMC4659612] [PMC8885328].

Literature search

66 open access papers mention mmu-mir-499
(607 sentences)

Sequence

16038 reads, 273 reads per million, 79 experiments

gggugggcagcugUUAAGACUUGCAGUGAUGUUUagcuccucugcauguGAACAUCACAGCAAGUCUGUGCUgcugccu
....(((((((.((..((((((((.((((((((((((......))...)))))))))).))))))))..)).)))))))

Structure

gggu       u  UA        A          ---  uc 
    gggcagc gU  AGACUUGC GUGAUGUUUa   gc  c
    ||||||| ||  |||||||| ||||||||||   ||   
    uccgucg CG  UCUGAACG CACUACAAGu   cg  u
----       U  UG        A          gua  uc 

Annotation confidence High

Genome context

chr2: 155622880-155622958 [+]

Mature mmu-miR-499-5p

• Accession: MIMAT0003482
• Description: Mus musculus mmu-miR-499-5p mature miRNA
• Sequence: 14 - UUAAGACUUGCAGUGAUGUUU - 34
• Evidence: experimental ; MPSS [1], cloned [2], Illumina [3-4]

Mature mmu-miR-499-3p

• Accession: MIMAT0017254
• Description: Mus musculus mmu-miR-499-3p mature miRNA
• Sequence: 50 - GAACAUCACAGCAAGUCUGUGCU - 72
• Evidence: experimental ; Illumina [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 20215419
   MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
   "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
   "Mol Hum Reprod (2010) 16:463-471


3. PubMed ID: 20413612
   Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
   "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
   "Genes Dev (2010) 24:992-1009


4. PubMed ID: 16582102
   The expression profile of microRNAs in mouse embryos
   "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
   "Nucleic Acids Res (2006) 34:1765-1771