miRBase entry: mmu-mir-455

Stem-loop mmu-mir-455


Accession
MI0004679
Symbol
MGI: Mir455
Description
Mus musculus mmu-mir-455 precursor miRNA mir-455
Gene
family?
RF00709; mir-455

Literature search
41 open access papers mention mmu-mir-455
(495 sentences)

Sequence

19968 reads, 371 reads per million, 103 experiments
cucccuggugugagcgUAUGUGCCUUUGGACUACAUCGugaacgcagcaccauGCAGUCCACGGGCAUAUACACuugccuca
.....(((.(((((.((((((((((.((((((.(((.(((.......))).))).)))))).)))))))))).))))).)))

Structure
cuccc   u     c          U      A   C   aa 
     ugg gugag gUAUGUGCCU UGGACU CAU Gug  c
     ||| ||||| |||||||||| |||||| ||| |||  g
     acu cguuC CAUAUACGGG ACCUGA Gua cac  c
-----   c     A          C      C   c   ga 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 63256851-63256932 [+]

Database links

Mature mmu-miR-455-5p

Accession MIMAT0003485
Description Mus musculus mmu-miR-455-5p mature miRNA
Sequence 17 - UAUGUGCCUUUGGACUACAUCG - 38
Evidence experimental
MPSS [1], miRAP-cloned [2], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-455-3p

Accession MIMAT0003742
Description Mus musculus mmu-miR-455-3p mature miRNA
Sequence 54 - GCAGUCCACGGGCAUAUACAC - 74
Evidence experimental
MPSS [1], miRAP-cloned [2], cloned [3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16973894
    Mouse microRNA profiles determined with a new and sensitive cloning method
    "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
    "Nucleic Acids Res (2006) 34:e115