Stem-loop ppt-MIR1220b

Accession

MI0004723

Description

Physcomitrella patens ppt-MIR1220b precursor miRNA

Sequence

acuucucggacuccucuaucucccucggcaccugcacagucauuuuaucaauaucuucacguugguggccacguucgaacauaucccaugcgggcaacuccggcguagguguacaaggccagcguugcuuaccaucuggaggauaccccugcucaaaccuacgacucugUUCCGGUGGUGAGGAAGAUAGaggaguucaagaagu
((((((.((((((((((((((.(((((.((((.(((.((((..........(((((((....(((((((.(((((.(..(.(((.((((((.((.....)).)))).)).)))...)..)))))).)).)))))....))))))).................)))).)))...)))).))))).)))))))))))))).))))))

Structure

      c              c     g    --u   c    -------auuuuaucaa       acgu     -  c     c aa --a   c  -    g  c 
acuucu ggacuccucuaucu ccucg cacc   gca aguc                 uaucuuc    uggug gc acguu g  c   uau cc augc gg a
|||||| |||||||||||||| ||||| ||||   ||| ||||                 |||||||    ||||| || ||||| |  |   ||| || |||| || a
ugaaga cuugaggaGAUAGA GGAGU GUGG   Ugu ucag                 auaggag    accau cg ugcga c  g   aug gg ugcg cc c
      a              A     G    CCU   c    cauccaaacucgucccc       gucu     u  u     - cg aac   u  a    g  u 

Annotation confidence Not enough data

Comments

The mature miRNA shown here is the predominant clone by deep sequencing [2]. Talmor-Neiman et al. identify an offset product by Northern blot [1].

Genome context

Chr03: 8671417-8671621 [-]

Mature ppt-miR1220b

• Accession: MIMAT0004832
• Description: Physcomitrella patens ppt-miR1220b mature miRNA
• Sequence: 170 - UUCCGGUGGUGAGGAAGAUAG - 190
• Evidence: experimental ; 454 [2]

References

1. PubMed ID: 17601824
   Common functions for diverse small RNAs of land plants
   "Axtell MJ, Snyder JA, Bartel DP"
   "Plant Cell (2007) 19:1750-1769


2. PubMed ID: 16824179
   Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss
   "Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T"
   "Plant J (2006) 47:25-37