bta-mir-29a, a microRNA, is notably expressed at higher levels in the adult bovine ovarian cortex compared to the fetal ovary, indicating a potential role in ovarian function and development [PMC2762473]. This microRNA was chosen for cellular localization studies due to its differential expression, suggesting its significance in reproductive tissues [PMC2762473]. Additionally, bta-mir-29a is among the miRNAs differentially expressed in bovine milk and plasma during early pregnancy [PMC6418173], and it has been implicated in processes related to pregnancy maintenance and immune function [PMC9445238]. Its stability has led to its proposed use as an internal control for normalizing qPCR data in studies involving bovine milk small extracellular vesicles (sEVs) [PMC9961204]. Network analysis further associates bta-mir-29a with key uterine proteins, indicating a strong interaction with reproductive processes at the molecular level [PMC8273763]. Despite variable expression patterns observed under different conditions, bta-mir-29a's consistent association with reproductive tissues underscores its potential as a biomarker for reproductive status and health in cattle [PMC5662615], while also being inversely correlated with lysosomal activity suggesting an involvement in cellular processes beyond reproduction [PMC9378797].
uuu c ucaa augacugauuuc ugguguu agag u |||||||||||| ||||||| |||| a uAUUGGCUAAAG ACCACGA UCuu u UCU - uuaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0003518 |
Description | Bos taurus bta-miR-29a mature miRNA |
Sequence | 41 - CUAGCACCAUCUGAAAUCGGUUA - 63 |
Evidence |
experimental
cloned [1-2] |
|