Bta-mir-29a is a microRNA that has been studied in various contexts. It has been found to be expressed at relatively higher levels in the ovarian cortical portion, with higher expression in the adult ovarian cortex compared to the fetal ovary [PMC2762473]. Bta-mir-29a has also been investigated as a potential internal control miRNA in bovine milk sEVs for normalization in qPCR [PMC9961204]. In addition, it has been identified as one of the miRNAs associated with uterine proteins and exhibited a strong and positive association with SUGT1 and PPID [PMC8273763]. Bta-mir-29a has also shown different abundance levels in pregnant vs. non-pregnant cows, with higher abundance levels observed in cows that reached term [PMC5662615]. Furthermore, it has been found to be negatively correlated with lysosome expression [PMC9378797]. Overall, bta-mir-29a is a microRNA that plays a role in ovarian development, pregnancy, and uterine protein regulation. It is also being investigated for its potential use as an internal control miRNA and its association with lysosome expression.
uuu c ucaa augacugauuuc ugguguu agag u |||||||||||| ||||||| |||| a uAUUGGCUAAAG ACCACGA UCuu u UCU - uuaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0003518 |
Description | Bos taurus bta-miR-29a mature miRNA |
Sequence | 41 - CUAGCACCAUCUGAAAUCGGUUA - 63 |
Evidence |
experimental
cloned [1-2] |
|