miRBase entry: bta-mir-484

Stem-loop bta-mir-484


Accession
MI0004749
Description
Bos taurus bta-mir-484 precursor miRNA

Literature search
2 open access papers mention bta-mir-484
(14 sentences)

Sequence

8506 reads, 99 reads per million, 73 experiments
gUCAGGCUCAGUCCCCUCCCGAUaaaccucuaaauagggaccuucccggggggcuaccucggc
((((((...((((((((.........(((......))).........)))))))).))).)))

Structure
   -   CUC        CCCGAUaaa   cu 
gUC AGG   AGUCCCCU         ccu  a
||| |||   ||||||||         |||   
cgg ucc   ucgggggg         gga  a
   c   --a        cccuuccag   ua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr25: 14245864-14245926 [+]

Database links

Mature bta-miR-484

Accession MIMAT0003535
Description Bos taurus bta-miR-484 mature miRNA
Sequence 2 - UCAGGCUCAGUCCCCUCCCGAU - 23
Evidence experimental
cloned [1]

References

  1. PubMed ID: 17105755
    Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
    "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
    "Physiol Genomics (2007) 29:35-43