Stem-loop bmo-mir-307

Accession

MI0004986

Description

Bombyx mori bmo-mir-307 precursor miRNA

Literature search

5 open access papers mention bmo-mir-307
(14 sentences)

Sequence

56 reads, 16 reads per million, 3 experiments

agcucguucccgguuACUCACUCAACCUGGGUGUGAUGugugcacucguugcucggcccaUCACAACCUCCUUGAGUGAGcgaucgucuaugagcc
.((((((...(((((.(((((((((...((.(((((((.(((((.....)))...)).))))))).))...))))))))).)))))...)))))).

Structure

a      ucc     A         CCU  G       u  ---   c 
 gcucgu   cgguu CUCACUCAA   GG UGUGAUG gu   gca u
 ||||||   ||||| |||||||||   || ||||||| ||   ||| c
 cgagua   gcuag GAGUGAGUU   CC ACACUac cg   cgu g
c      ucu     c         CCU  A       c  gcu   u 

Annotation confidence Not enough data

Genome context

NW_004582026.1: 4749629-4749724 [-]

Mature bmo-miR-307-5p

• Accession: MIMAT0015237
• Description: Bombyx mori bmo-miR-307-5p mature miRNA
• Sequence: 16 - ACUCACUCAACCUGGGUGUGAUG - 38
• Evidence: experimental ; Illumina [4]

Mature bmo-miR-307-3p

• Accession: MIMAT0004208
• Description: Bombyx mori bmo-miR-307-3p mature miRNA
• Sequence: 61 - UCACAACCUCCUUGAGUGAG - 80
• Evidence: experimental ; RT-PCR [3], Illumina [4]

References

1. PubMed ID: 16972323
   Computational prediction of microRNA genes in silkworm genome
   "Tong CZ, Jin YF, Zhang YZ"
   "J Zhejiang Univ Sci B (2006) 7:806-816


2. PubMed ID: 18507836
   Identification and characteristics of microRNAs from Bombyx mori
   He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y
   BMC Genomics (2008) 9:248


3. PubMed ID: 18977439
   Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system
   "Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y"
   "Insect Biochem Mol Biol (2008) 38:1066-1071


4. PubMed ID: 20199675
   MicroRNAs of Bombyx mori identified by Solexa sequencing
   Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q
   BMC Genomics (2010) 11:148