miRBase entry: ebv-mir-BART18

Stem-loop ebv-mir-BART18


Accession
MI0004991
Description
Epstein Barr virus ebv-mir-BART18 precursor miRNA

Literature search
1 open access papers mention ebv-mir-BART18
(1 sentences)

Sequence


uuguugccguugaaagacggguguccuggcUCAAGUUCGCACUUCCUAUACAguguuaaagccuugUAUCGGAAGUUUGGGCUUCGUCccaguguacucgauaaugucgacugcugcga
((((.((.(((((....((((((.(((((..((((((((.((((((.((((((.((....)).)))))).)))))).))))))).)..)))).)))))))......))))).)).))))

Structure
    u  c     --aaga      u -    cU -       C      U      u  u 
uugu gc guuga      cgggug c cugg  C AAGUUCG ACUUCC AUACAg gu a
|||| || |||||      |||||| | ||||  | ||||||| |||||| |||||| ||  
agcg cg cagcu      gcucau g gacc  G UUCGGGU UGAAGG UAUguu cg a
    u  u     guaaua      - u    CU C       U      C      c  a 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART10 by Grundhoff et al [1] but is not related to ebv-miR-BART10 (MIR:MI0003732). The mature miRNA names and sequences reflect cloning frequencies from Landgraf et al. [2], and may differ subtly from previous annotations.

Genome context
HHV507799: 145932-146050 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from ebv-mir-BART18
Name Accession Chromosome Start End Strand Confidence




Disease association
ebv-mir-BART18 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature ebv-miR-BART18-5p

Accession MIMAT0003717
Description Epstein Barr virus ebv-miR-BART18-5p mature miRNA
Sequence 31 - UCAAGUUCGCACUUCCUAUACA - 52
Evidence experimental
array [1], Northern [1], cloned [2]

Mature ebv-miR-BART18-3p

Accession MIMAT0004835
Description Epstein Barr virus ebv-miR-BART18-3p mature miRNA
Sequence 67 - UAUCGGAAGUUUGGGCUUCGUC - 88
Evidence experimental
cloned [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16540699
    A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
    "Grundhoff A, Sullivan CS, Ganem D"
    "RNA (2006) 12:733-750