miRBase entry: gga-mir-21

Stem-loop gga-mir-21


Accession
MI0004994
Description
Gallus gallus gga-mir-21 precursor miRNA mir-21
Gene
family?
RF00658; mir-21

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Gga-mir-21 is a differentially expressed miRNA in chickens that has been studied in relation to its role in fighting against Infectious Bursal Disease Virus (IBDV) [PMC3700833]. To validate the Illumina small RNA deep sequencing data, five differentially expressed miRNAs, including gga-mir-21, were selected and their expression levels were quantified using real-time quantitative RT-PCR (qRT-PCR) [PMC3700833]. The study found that gga-mir-21 is upregulated in chickens as a defense mechanism against IBDV by inhibiting viral replication [PMC5097849]. This suggests that gga-mir-21 plays a role in the immune response to IBDV infection in chickens. The upregulation of gga-mir-21 may be a protective mechanism to limit viral replication and reduce the severity of the infection. This finding highlights the importance of miRNAs, such as gga-mir-21, in modulating immune responses and fighting against viral infections. Further research is needed to fully understand the mechanisms by which gga-mir-21 functions and its potential as a therapeutic target for IBDV infections [PMC5097849].

Literature search
31 open access papers mention gga-mir-21
(211 sentences)

Sequence

1933092 reads, 34970 reads per million, 5 experiments
uguaccauccugucggaUAGCUUAUCAGACUGAUGUUGAcuguuggaucucauggCAACAACAGUCGGUAGGCUGUCugacauuuugguaucucuca
.((((((...((((((((((((((((.(((((.(((((.((((........))))))))).)))))))))))))))))))))...))))))......

Structure
-----u      ucc                A     A     A    ugg 
      guacca   ugucggaUAGCUUAUC GACUG UGUUG cugu   a
      ||||||   |||||||||||||||| ||||| ||||| ||||    
      uauggu   acaguCUGUCGGAUGG CUGAC ACAAC ggua   u
acucuc      uuu                -     A     -    cuc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr19: 7376247-7376343 [+]

Database links

Mature gga-miR-21-5p

Accession MIMAT0003774
Description Gallus gallus gga-miR-21-5p mature miRNA
Sequence 18 - UAGCUUAUCAGACUGAUGUUGA - 39
Evidence experimental
cloned [1-2], Northern [1], Illumina [3]
Database links
Predicted targets

Mature gga-miR-21-3p

Accession MIMAT0026643
Description Gallus gallus gga-miR-21-3p mature miRNA
Sequence 56 - CAACAACAGUCGGUAGGCUGUC - 77
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 18256158
    MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs
    "Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V"
    "J Virol (2008) 82:4007-4015

  2. PubMed ID: 16750530
    Identification of microRNAs from different tissues of chicken embryo and adult chicken
    "Xu H, Wang X, Du Z, Li N"
    "FEBS Lett (2006) 580:3610-3616

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45