Bta-mir-22 is a microRNA that has been identified as a potential regulator of tenderness and is involved in calcium signaling in the heart [PMC6182065]. It targets the mitochondrial L-carnitine shuttle pathway and glutathione reductase (GSR) [PMC6182065]. Bta-mir-22 also targets genes involved in calcium signaling, such as the calcium channel, voltage-dependent, N type, alpha 1B subunit (CACNA1B) and ATPase, calcium-transporting, plasma membrane 2 (ATP2B2) [PMC6182065]. It also targets genes from the Calpain family, including calpain 1 (CAPN1) and calpain 11 (CAPN11), as well as calpastatin (CAST) [PMC6182065]. Bta-mir-22 has been found to be differentially expressed in bovine macrophages in response to M. bovis expression [PMC4978967]. The 3p arm of bta-mir-22 precursor is functionally more relevant than the corresponding 5p arm during the late follicular phase of preovulatory stage of bovine estrous cycle [PMC4438052]. Bta-mir-22 has also been identified as miR-22* [PMC2762473].
u cc - A u ccu ggc gag gcaguAGUUCUUCAG UGGCA GCUUUA gu g ||| ||| ||||||||||||||| ||||| |||||| || a ccg cuc cguuGUCAAGAAGUU ACCGU CGAAau cg c u -c G - - acc
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0003826 |
Description | Bos taurus bta-miR-22-5p mature miRNA |
Sequence | 15 - AGUUCUUCAGUGGCAAGCUUUA - 36 |
Evidence |
experimental
cloned [1], Array [2], qRT-PCR [2] |
Accession | MIMAT0012536 |
Description | Bos taurus bta-miR-22-3p mature miRNA |
Sequence | 53 - AAGCUGCCAGUUGAAGAACUG - 73 |
Evidence |
experimental
cloned [3] |
|