Stem-loop osa-MIR815c

Accession

MI0005244

Description

Oryza sativa osa-MIR815c precursor miRNA

Literature search

2 open access papers mention osa-MIR815c
(2 sentences)

Sequence

808 reads, 556 reads per million, 2 experiments

cuucuccucucuucucuccuccaccucagcauuuagccggcuuauagccuauacuuccucuaaggguguguuugaggagAAGGGGAUUGAGGAGAUUGGGaag
((((((.(((((((((((((.(.(((((((.....)).((((...)))).((((.((((...)))).)))).))))).).))))))..)))))))..))))))

Structure

      -c       --      c a     gcauuuagccggcuuauagccu    u    c 
cuucuc  ucucuuc  ucuccu c ccuca                      auac uccu  
||||||  |||||||  |||||| | |||||                      |||| |||| u
gaaGGG  AGAGGAG  AGGGGA g ggagu                      ugug ggga  
      UU       UU      A a     ---------------------u    u    a 

Annotation confidence Low

Comments

miR815 was misnamed miR574 by Luo et al [1]. The identified mature sequence maps many times to the rice genome, and overlaps annotated transposon and siRNA loci. This entry may therefore represent an siRNA rather than a miRNA, and may be removed from future database releases.

Genome context

Chr7: 5426885-5426987 [-]

Mature osa-miR815c

• Accession: MIMAT0004060
• Description: Oryza sativa osa-miR815c mature miRNA
• Sequence: 80 - AAGGGGAUUGAGGAGAUUGGG - 100
• Evidence: experimental ; cloned [1], Northern [1]

References

1. PubMed ID: 16959252
   Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development
   "Luo YC, Zhou H, Li Y, Chen JY, Yang JH, Chen YQ, Qu LH"
   "FEBS Lett (2006) 580:5111-5116