miRBase entry: mdo-mir-187

Stem-loop mdo-mir-187


Accession
MI0005309
Description
Monodelphis domestica mdo-mir-187 precursor miRNA


Sequence

18788 reads, 329 reads per million, 5 experiments
auugugagaccucUGGCUACAACACAGGACACGGGAgcuuuucugaacccUCGUGUCUUGUGUUGCAGCCagaggggcaca
..((((...(((((((((.((((((((((((((((.(.((....)).).)))))))))))))))).)))))))))..))))

Structure
au    aga         A                A c  u 
  ugug   ccucUGGCU CAACACAGGACACGGG g uu u
  ||||   ||||||||| |||||||||||||||| | ||  
  acac   ggagaCCGA GUUGUGUUCUGUGCUc c ag c
--    -gg         C                c a  u 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr3: 87606200-87606280 [+]

Database links

Mature mdo-miR-187-3p

Accession MIMAT0004120
Description Monodelphis domestica mdo-miR-187-3p mature miRNA
Sequence 51 - UCGUGUCUUGUGUUGCAGCC - 70
Evidence experimental
Microarray [1], PCR [1], Illumina [2]

Mature mdo-miR-187-5p

Accession MIMAT0026674
Description Monodelphis domestica mdo-miR-187-5p mature miRNA
Sequence 14 - UGGCUACAACACAGGACACGGGA - 36
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 17965199
    In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica
    "Devor EJ, Samollow PB"
    "J Hered (2008) 99:66-72

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45