miRBase entry: mdo-mir-181a-3

Stem-loop mdo-mir-181a-3


Accession
MI0005310
Description
Monodelphis domestica mdo-mir-181a-3 precursor miRNA


Sequence

1489707 reads, 26509 reads per million, 5 experiments
ugggggAACAUUCAACGCUGUCGGUGAGUuugagcagcugaaggcaaaCCAUCGACCGUUGAGUGGACCccg
..((((..(((((((((..(((((((.(((((............)))))))))))))))))))))..)))).

Structure
ug    AA         CU       A     agcag 
  gggg  CAUUCAACG  GUCGGUG GUuug     c
  ||||  |||||||||  ||||||| |||||      
  ccCC  GUGAGUUGC  CAGCUAC Caaac     u
-g    AG         --       -     ggaag 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr3: 446461502-446461573 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mdo-mir-181a-3
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mdo-miR-181a-5p

Accession MIMAT0004154
Description Monodelphis domestica mdo-miR-181a-5p mature miRNA
Sequence 7 - AACAUUCAACGCUGUCGGUGAGU - 29
Evidence experimental
Illumina [1]
Database links
Predicted targets

Mature mdo-miR-181a-3-3p

Accession MIMAT0031039
Description Monodelphis domestica mdo-miR-181a-3-3p mature miRNA
Sequence 49 - CCAUCGACCGUUGAGUGGACC - 69
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 17965199
    In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica
    "Devor EJ, Samollow PB"
    "J Hered (2008) 99:66-72

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45