miRBase entry: mdo-mir-181a-1

Stem-loop mdo-mir-181a-1


Accession
MI0005343
Description
Monodelphis domestica mdo-mir-181a-1 precursor miRNA


Sequence

1491956 reads, 26510 reads per million, 5 experiments
ugAACAUUCAACGCUGUCGGUGAGUuuggaauuaaaaugaaaaCCAUCGACCGUUGAUUGUACC
...(((.((((((..(((((((.((((.............))))))))))))))))).)))...

Structure
ugA   U      CU       A    ggaau 
   ACA UCAACG  GUCGGUG GUuu     u
   ||| ||||||  ||||||| ||||     a
   UGU AGUUGC  CAGCUAC Caaa     a
CCA   U      --       -    aguaa 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr2: 99873079-99873142 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mdo-mir-181a-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mdo-miR-181a-5p

Accession MIMAT0004154
Description Monodelphis domestica mdo-miR-181a-5p mature miRNA
Sequence 3 - AACAUUCAACGCUGUCGGUGAGU - 25
Evidence experimental
Illumina [1]
Database links
Predicted targets

Mature mdo-miR-181a-1-3p

Accession MIMAT0026698
Description Monodelphis domestica mdo-miR-181a-1-3p mature miRNA
Sequence 44 - CCAUCGACCGUUGAUUGUACC - 64
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 17965199
    In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica
    "Devor EJ, Samollow PB"
    "J Hered (2008) 99:66-72

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45